>AB209346 Homo sapiens mRNA for thyroid hormone receptor, alpha isoform 1 variant protein (4984 bp)
ACAGAGAATAGAAAGAGCCTATATGGAGAAGGGTGACGTTGGAAAAGGGAGGCAGTGGAT
CGGTATTGATGTTAGAAATGAGAGGGGAGGGAGGTAACAGGGAATGAACCCCCACAAGGA
TGAAAAACGTAAGATGATTGAAGTTAAAAGGACATCAGGGGTCACCTGCCCAGCCCTCGC
AGCTGAAGCTTGAGGAAGCTCTGCCCCCGACAGCAGTGGCGATTTGTCAAGGTCACACAG
TGAGTTACCGGCGGAGAAGGGACCCGAACTCCCAAACAAACTACACCTGCAAGCGTTTGA
TGTTTAGACTTTCTCCCCGATGTATAAGGGATCTCTGGACAGGACAAGACTCCGAAGCTA
CTCCCCCAGCACACAGCCCGGGACCCACAAacccagcttgcccccagccctcccacctgc
cactccctggcccctcccaccgcccgccCCCCTTGGGGCGCAGGGCATGGTGTGAAAGGC
CAAGTGCTGAGGCGGGTATCATGGGTGCTGTGCCCtagggcctgggtggcagggggtggg
tggcctgtgggtgtgccgggggggccagtgtgCCCACCCCAGTCTCTTGGCGTGCTGGAG
GGCATCCTGGATGGAATTGAAGTGAATGGAACAGTGCCAGGTCACCAGATGGAAAGCGAA
AAAGAAAGAACGGCCAATGTTCCCTGAAAACCAGCATGTCAGGGTATATCCCTAGTTACC
TGGACAAAGACGAGCAGTGTGTCGTGTGTGGGGACAAGGCAACTGGTTATCACTACCGCT
GTATCACTTGTGAGGGCTGCAAGGGCTTCTTTCGCCGCACAATCCAGAAGAACCTCCATC
CCACCTATTCCTGCAAATATGACAGCTGCTGTGTCATTGACAAGATCACCCGCAATCAGT
GCCAGCTGTGCCGCTTCAAGAAGTGCATCGCCGTGGGCATGGCCATGGACTTGGTTCTAG
ATGACTCGAAGCGGGTGGCCAAGCGTAAGCTGATTGAGCAGAACCGGGAGCGGCGGCGGA
AGGAGGAGATGATCCGATCACTGCAGCAGCGACCAGAGCCCACTCCTGAAGAGTGGGATC
TGATCCACATTGCCACAGAGGCCCATCGCAGCACCAATGCCCAGGGCAGCCATTGGAAAC
AGAGGCGGAAATTCCTGCCCGATGACATTGGCCAGTCACCCATTGTCTCCATGCCGGACG
GAGACAAGGTGGACCTGGAAGCCTTCAGCGAGTTTACCAAGATCATCACCCCGGCCATCA
CCCGTGTGGTGGACTTTGCCAAAAAACTGCCCATGTTCTCCGAGCTGCCTTGCGAAGACC
AGATCATCCTCCTGAAGGGGTGCTGCATGGAGATCATGTCCCTGCGGGCGGCTGTCCGCT
ACGACCCTGAGAGCGACACCCTGACGCTGAGTGGGGAGATGGCTGTCAAGCGGGAGCAGC
TCAAGAATGGCGGCCTGGGCGTAGTCTCCGACGCCATCTTTGAACTGGGCAAGTCACTCT
CTGCCTTTAACCTGGATGACACGGAAGTGGCTCTGCTGCAGGCTGTGCTGCTAATGTCAA
CAGACCGCTCGGGCCTGCTGTGTGTGGACAAGATCGAGAAGAGTCAGGAGGCGTACCTGC
TGGCGTTCGAGCACTACGTCAACCACCGCAAACACAACATTCCGCACTTCTGGCCCAAGC
TGCTGATGAAGGTGACTGACCTCCGCATGATCGGGGCCTGCCACGCCAGCCGCTTCCTCC
ACATGAAAGTCGAGTGCCCCACCGAACTCTTCCCCCCACTCTTCCTCGAGGTCTTTGAGG
ATCAGGAAGTCTAAAGCCTCAGGCGGCCAGAGGGTGTGCGGAGCTGGTGGGGAGGAGCCT
GGAGAGAAGGGGCAGAGCTGGGGGCTGAGGGAGACCCCCCCACACCCCTTCTCTCCTTCC
TCTCGTCCTTGGATAGATTCAGCTCCCACACACACACCCGCACTGCCCAGGTCCCTCCTC
AGACCTCCAGCCCTGGGACAGGGCAAACAACTGAACTTGCTATGGAAAGGACAGTGTGGG
AGGCTGGGGGAGCTGTGTCCTGCAGTTCCCAGGACCCCATCCTCTCAGAAGGTAGGGGAA
GGGCGGGAGGATTGAGAAGGGACAAGCCACCTTGACCGTAGGGGAAGGAGGAATGTGGGC
TGGGGGAAGATGCCCTCAACTCACCCCCTACACACACATGAGAGAGAGCCCCCACCCAGT
TCCTTGGCCTAGGTCTCCCCTCCAGGCTGAGGGCCTCTCTACTTCCCCAGATGCCTGGGT
GCAAAGAACGGCTTGGCTTGGCTCCTCCTCTGGAGGTTAAAATTTATAGTCATTCTAACT
GCACTTTGGAAACCAAGCAAGGGGAGAAGACAAATGAagaaaaactagacagagagaaaa
atacaaaaaagagagagcgagcgatagagagagaTGATATTAAGTTATTAACTGAGGCTG
ACCAGAGGGGAGGaccccccctttaccaccccatgcactttgcgagctgccccttcttcc
cccaCATCAGAGAGAAATGCCCCCACACCAGAGCCCCAAGGGTAGGGCTGCCGATCAGAG
CTGTGAGTTAACACAACAGGGTCCTGGCCaccccccttgccataccccgccctctgtgcc
cctttggcaccccccAACCCTAGTATGTCCTCTGCTTTCTGCCACTCGTGCCCGCTGAGT
TCCATCTACCTCTCATGCTGGATGCCAGCTGGCCCCTCACCAGCCTGCCCTGCTGCCCAC
ACAGCTCCCCTTTAAGTGCCCAGCCCTAGGGGCCTCTCCCCATCCACCTCCTCCTTCCAC
ACCTTGGCACCCACCCAGGAAAAAACTGTGGCTCCAACTCCTACCCTCCTTATATCCTGC
AGTATTAGCTAGAAACCGGATGCTGCTGCATTGGTTGGGTCGGGGGTAGGAGGGCTGTGC
GTGAGCGTCTCCCAGAACCCTCCACCCCTTTAGCACTCTGTTTCCCTGTTTCCCATCTGT
CTTCTGGGCTCTCTCTAACCTCTGCCCTCCTCCCCAGCTCCTACTCACTGCACTAACTCT
GGGCGGGCAGGTACCAGAATGGGGGTGTTTAGATAAGTGACACTTAGTTGGGGCCCCAGG
GGAGGGGTGGTCGGTGCTCCTTTTTCTTTAAAGCTCTTTTGGCCAGCTGCCCCTCTGCCC
CGGGACCCCTTCCCCTCTTCTTTTCTCTAATTCAGGGACTTTGGCTTGAGCCCCTCTCGC
CCTCCTGGTGAGGGTGCTCTGTTGGTCTGCACTTGGGTGAGCTGTCCTCCTCCCCCTCCC
TGTGGCTGCCGCCCACTCCTCaggggagagagggagagaggagGTGGTCCTCCCATGGGA
GCAGGAGGTGGGGTGGGACAGAGCAGACCAGAGGGTGCTGGGCTCAGGGCTGCATGTCGG
CAGGGATGGATGGGTGGACACAGATGCCCCCCGGAAGCCAtggggattggggcagggggt
ggggggaggggTGCCAGGGCTTCCTGCGCTTTGCACTATTGGGGCAAAAATGTCTTAAGC
AGTGGGGAACCTGCCACCCCACCCTGACCCTCAGCCTGCCACAGCCCCCTacacacacac
acacacacacacacacacacacacacacacggacatgcacacacGGACATGGGAAGGCAA
TGCTATGCTGCCCGTCAGGGCACTGTCCTTCCCCAATCGTTCAGGTGTTCCAACAGGGGT
GGAGGGCCTGGAGGAGCACCCGCTGTCACCTGTGCATGTGCCTGTCCCACCCTGCTGGGG
CCTCGGGCTGCCCGCGCTGTCTTTGtctctatcctctctctctctcCTGGAGTACTGAAT
CCTGTATTACTCCAGTCCCATGGGTAGGCCCTCTTGTACCTTCCTACCACGCCTGGGGGC
CCAGTGGAATTCCTGACCTGTCTGCTGTCTtccccatccctccatccccaccccaacccc
tccatccccaTTCTCAGCCATGGACACGGCAGAGAAAAGGCCTTGAAGAGACTTAGCCTC
TTATAGGCACTTGGGACTCCCCCACCCTCCCCAATCATATGAGCTGTGAtcccatcctcc
ccggacccctcccttccccctCGGTGATGTGGGGTGTATGTGTGCGTTCCTCTGCGTGAA
TGTGTGAGTGAGTACACATGGTAGGGGAGGAGCCAGGGCGACTCAGGAGTGCCACGCACC
TGCTCTAGAGCGGCAGCTGTCCCAGTCCCTGCTGTGGAAGTGGGGGACAGGGCCCTCTCC
TGGGGGCCATTGGTGCTAATGAGGGGGATGGCCTTGATGTGGGTGCTCAGCATGCCTCCC
CCAGTATTGGCCCGGGGCACTAGGGCAGGCAGGGTGGAGCAGCAGGTGCAGTATCGGTGG
GAGGACGGGTTGCTGGGAATAGGACGAGGGGGCCAGGCCAGGACAAGGGGTTGCCAGAGC
CATGACCACTACCCCGCCCCCACCACCCGCCTCTCCATCTCAGTATTGCCCCTCCCATCA
CTCATAACACACATACCTCATCCAGCCTCCTCCCTGCTCAGACTTGGGGAGGGTGGGGGA
GGAGCCCCTACCCCTTCTCCTGGTGGCGGGTCTGCAGGGCTGGGAGAGGGCAGGGCGTTG
TGAGAGAGAGACCGTCCATAAGGAGGACAGTAACTCCTGCCCTGGGAACTCCTGGGCggg
ggggagggggACACTGCCCAGAGGCGCTACTGAATGTATGAGAAGCTGGTGCTGGGCTgg
ggggaggggggTTGTGGCCAGAAACAGGGAAGGAGGTAGGTCTCTTCCCCAGGGAGGGGT
GGGACCGGCAGGGGTGACTTGAGGGGCTCCTACTCCTGCCCCACGTTGACAATCAGTATG
TCTGTTATGTGCGATTTTTCACCCCGTTGTGTTTTGGGTCAGGATTTTAAAGAAAGATAT
TTTTATGGTAATTGTTGCTCGTCTATTTTACTATATATTTATGTAATAAATATATGATGA
AAAT