>AF522368 Homo sapiens thyroid hormone receptor alpha3 mRNA, partial cds (392 bp)
ATGGCTGTCAAGCGGGAGCAGCTCAAGAATGGCGGCCTGGGCGTAGTCTCCGACGCCATC
TTTGAACTGGGCAAGTCACTCTCTGCCTTTAACCTGGATGACACGGAAGTGGCTCTGCTG
CAGGCTGTGCTGCTAATGTCAACAGACCGCTCGGGCCTGCTGTGTGTGGACAAGATCGAG
AAGAGTCAGGAGGCGTACCTGCTGGCGTTCGAGCACTACGTCAACCACCGCAAACACAAC
ATTCCGCACTTCTGGCCCAAGCTGCTGATGAAGGTCCGGCAGCTTGAGCAGCAGCTTGGT
GAAGCGGGAAGTCTCCAAGGGCCGGTTCTTCAGCACCAGAGCCCGAAGAGCCCGCAGCAG
CGTCTCCTGGAGCTGCTCCACCGAAGCGGAAT