>AK093659 Homo sapiens cDNA FLJ36340 fis, clone THYMU2006468 (2235 bp)
ACGCCTTGGGGACTGCGTTTGGCTTCATCAGGTGCACCTGGCCAGGAAGGGAGCACAGGC
AGGGGCATGAGGCCAGTGGCCTCCTCTGAGGACCCACCTAGCCCCGCCCCAGCTCCACCT
GCTCCCTGCCCTGGCCATCTCCAAGCCACATGGGAGCAGCACAATAATAAGAATTATTAA
CAGGAATAAGAGCAGCCCTGAGAGCTCTGGGAGCGGGAGCTGTGGTGGCCCACAGTGCCC
AGGGAGGGATACATGGCAGCCCCAGGGTGTGGGGCAGGTGGGCAGGGCACTAATGAGGGG
CCTCGAGTCCCAGGCCAAGGGCTCAGACTTCCTCCTGGGGATAATGGGAAGGAGAACCTC
ATGGCCAGGTTTGTGCCCTTAGTGAGGTCCCCAAGGGGGAACCTGGAAGGACCACTGTCT
TCTTATAGCCCTTCAGACCCCCCCAGAGGctctgcctccccacaccctggcctccctccc
caggctctgggaggccaggcctcgccccctcTCCTGTGCTGCTCCTTCTCCCAGAGGACT
GCATCCGCCCTCAGCACTTCAAGGCCCTGCATGTGCCCGCACCTCTCCACTCCCCTGGCT
CAGCTTGGACCTCTCTTCTGAACTCCAGACTTGCGGATCCTGCTCCCCTTCCCACTTCTG
CACTTGGGGGTCTAATGAGGCCTCAGTGGAACATAGAATTCCTCCCGCCCTGACATCATA
GCTCCCGCCTGGGAGGCCTCCTGGATGACTCCTTTCGCCTCCTCCCTTCCCTGAGAGCAG
CCCCTGGCTCAACCTCCACCTCCGTGCTGCCTCGGACCACCTGCCCAGTCGAGCTGCCAT
CACCTGCCAGGTGACCACAGCAGCCCTCACTCATCCCCTGCTCCTCTGCCTTCCACTCCC
GCGACCATCAGCCTCCCCAAGCCAGAAAGGTCCTTCTGGAGGGTGACGCAGACCAGGACA
CTGCTTTGCTGAAGACCTCTGACAGCCTCTGGGGTTGCTTGGAATAAAATCCACCCTCCT
TCCCAGGGAACCCCAGGCCCTACGGGAGCTGGCCTGgctcaccccggcatcacctccctc
cactctcctccccttcactgcacccagcccctctcctcccTGCTGGCCCTGAACTTAGGG
CCAGCCTGCTCCTGTCTTAGGGCCTTGCACTTGCTCCTTCTGGAACATTCCTCCTCCAGC
TGCTGACGTGCCCCTCCTTGTGTGGAGAGGCTGGGCCCAGTCTCACTCCACTGACGGCAC
GGCTGCTCTGCTCTTCCTCACAGGAGGTGTCAACTCCACGGTTGGTTTGCTTCTGTGCCC
ACCGACAGCCTCCCCTAGAGCACAGTGCCTGTTTGCTGCCCTGTAGGCTGTGAGCACTCA
CTCTAGTTGAGCCCCTGAGGGGCAGGGGCAAGGGCAGAGGAGATGGAGTCCGGGAGCTGC
AGGTGCAGTCACCTTCCCATGTACCTCCCACACATGCAGCTGTGAGAACCACACGGCATA
AAGGGTGGCTGGGCCAGGCCACCCCACGCGTCCTCATCACCCCTGGGCCTTTCCAAGGAG
ATGGCTCCAGGTGTCCAGCAAACACCATTTGACTGCCCAGAAAGGAAGTATTATCATAGG
CTCAGAGCAGCTTTTGGTAATTTCTTTCCTCTCACACCAAGGCATTGTGTGCGCACgtgt
gtgtgtgtgtgtgtgtgtgtgtgtgtTTTAATTTTTATTTTAGAGACAGGGTTTTGCTGT
GTTGCTCAGGCTTGTCTTGAACTTCTGGGCTCGTGTGCTGCGATTACAGGGTGAGCCACT
GCGCCTGATCAAGGCATCACCGTTGAACCTCCTAAGAGGAAAACATAAGGCTGTGCAATA
CCAGGAACTGGGATTCTAGGTTGCCCCAGACACCAAGGCATCAAAAGCCAGGGGATCCAG
AAAAAACACAGACAGCCAAGAGAGAAACTGCGGGAAAAAGCCAAAAGGTTGAGAGCCACA
CCATCTAGAAGCTTCCTGCCTGTGGTGCGGCACAGAAACAAGGAGAGTCAGCAATTACCA
GCCAGCCAAGGTCCTGGAAGCTGACGTAGAGCTCGTGCCGACGGCAGACCTGCCGGCCGT
GGGAGCCGTGGACGTCATCTGCAGGGACAGAAGGGGCAAGGTCTTTTCTGGGGTTCCTAC
TGTGTGCAGCTACTATGGGGTACCAGGGTGGGGGATGCCCTGATGAGCACATTTGTCAAA
TAAATGAATGACAGG