>BC002728 Homo sapiens thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian), transcript variant 2, mRNA (cDNA clone MGC:3645 IMAGE:3628335), complete cds (2413 bp)
CTCGCACTCACACCCGGGCGCAGGAGGCGGGCggcccgggccccaccggccccccatgga
cgcccccagcacggggcgctgagacccccGCGTCGCTGCCCAGCCCGGTCCGGCGCGCCA
CGCCGAGGGATCTCTGGACAGGACAAGACTCCGAAGCTACtcccccagcacacagcccgg
gacccacaaacccagcttgcccccagccctcccacctgccactccctggcccctcccacc
gcccgcccccctTGGGGCGCAGGGCATGGTGTGAAAGGCCAAGTGCTGAGGcgggtatca
tgggtgctgtgccctagggcctgggtggcagggggtgggtggcctgtgggtgtgccgggg
gggccagtgtgCCCACCCCAGTCTCTTGGCGTGCTGGAGGGCATCCTGGATGGAATTGAA
GTGAATGGAACAGAAGCCAAGCAAGGTGGAGTGTGGGTCAGACCCAGAGGAGAACAGTGC
CAGGTCACCAGATGGAAAGCGAAAAAGAAAGAACGGCCAATGTTCCCTGAAAACCAGCAT
GTCAGGGTATATCCCTAGTTACCTGGACAAAGACGAGCAGTGTGTCGTGTGTGGGGACAA
GGCAACTGGTTATCACTACCGCTGTATCACTTGTGAGGGCTGCAAGGGCTTCTTTCGCCG
CACAATCCAGAAGAACCTCCATCCCACCTATTCCTGCAAATATGACAGCTGCTGTGTCAT
TGACAAGATCACCCGCAATCAGTGCCAGCTGTGCCGCTTCAAGAAGTGCATCGCCGTGGG
CATGGCCATGGACTTGGTTCTAGATGACTCGAAGCGGGTGGCCAAGCGTAAGCTGATTGA
GCAGAACCGGGAGCGGCGGCGGAAGGAGGAGATGATCCGATCACTGCAGCAGCGACCAGA
GCCCACTCCTGAAGAGTGGGATCTGATCCACATTGCCACAGAGGCCCATCGCAGCACCAA
TGCCCAGGGCAGCCATTGGAAACAGAGGCGGAAATTCCTGCCCGATGACATTGGCCAGTC
ACCCATTGTCTCCATGCCGGACGGAGACAAGGTGGACCTGGAAGCCTTCAGCGAGTTTAC
CAAGATCATCACCCCGGCCATCACCCGTGTGGTGGACTTTGCCAAAAAACTGCCCATGTT
CTCCGAGCTGCCTTGCGAAGACCAGATCATCCTCCTGAAGGGGTGCTGCATGGAGATCAT
GTCCCTGCGGGCGGCTGTCCGCTACGACCCTGAGAGCGACACCCTGACGCTGAGTGGGGA
GATGGCTGTCAAGCGGGAGCAGCTCAAGAATGGCGGCCTGGGCGTAGTCTCCGACGCCAT
CTTTGAACTGGGCAAGTCACTCTCTGCCTTTAACCTGGATGACACGGAAGTGGCTCTGCT
GCAGGCTGTGCTGCTAATGTCAACAGACCGCTCGGGCCTGCTGTGTGTGGACAAGATCGA
GAAGAGTCAGGAGGCGTACCTGCTGGCGTTCGAGCACTACGTCAACCACCGCAAACACAA
CATTCCGCACTTCTGGCCCAAGCTGCTGATGAAGGAGAGAGAAGTGCAGAGTTCGATTCT
GTACAAGGGGGCAGCGGCAGAAGGCCGGCCGGGCGGGTCACTGGGCGTCCACCCGGAAGG
ACAGCAGCTTCTCGGAATGCATGTTGTTCAGGGTCCGCAGGTCCGGCAGCTTGAGCAGCA
GCTTGGTGAAGCGGGAAGTCTCCAAGGGCCGGTTCTTCAGCACCAGAGCCCGAAGAGCCC
GCAGCAGCGTCTCCTGGAGCTGCTCCACCGAAGCGGAATTCTCCATGCCCGAGCGGTCTG
TGGGGAAGACGACAGCAGTGAGGCGGACTCCCCGAGCTCCTCTGAGGAGGAACCGGAGGT
CTGCGAGGACCTGGCAGGCAATGCAGCCTCTCCCTGAAGCCCCCCAGAAGGCCGATGGGG
AAGGAGAAGGAGTGCCATACCTTCTCCCAGGCCTCTGCCCCAAGAGCAGGAGGTGCCTGA
AAGCTGGGAGCGTGGGCTCAGCAGGGCTGGTCACCTCCCATCCCGTAAGACCACCTTCCC
TTCCTCAGCAGGCCAAACATGGCCAGACTCCCTTGCTTTTTGCTGTGTAGTTCCCTCTGC
CTGGGATGCCCTTCCCCCTTTCTCTGCCTGGCAACATCTTACTTGTCCTTTGAGGCCCCA
ACTCAAGTGTCACCTCCTTCCCCAGCTCCCCCAGGCAGAAATAGTTGTCTGTGCTTCCTT
GGTTCATGCTTCTACTGTGACACTTATCTCACTGTTTTATAATTAGTCGGGCATGAGTCT
GTTTCCCAAGCTAGACTGTGTCTGAATCATGTCTGTATCCCCAGTGCCCGGTGCAGGGCC
TGGCATAGAGTAGGTACTCCATAAAAGGTGTGTTGAATTGaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaa