>BC047875 Homo sapiens, Similar to nuclear receptor subfamily 1, group D, member 1, clone IMAGE:6190140, mRNA (2606 bp)
CGTCTCGCCTCTTTGCGACTCGGTGCCCCGTTTCTCCCCATCACCTACTTACTTCCTGGT
TGCAACCTCTCTTCCTCTGGGACTTTTGCACCGGGAGCTCCAGATTCGCCACCCCGCAGC
GCTGCGGAGCCGGCAGGCAGAGGCACCCCGTACACTGCAGAGACCCGACCCTCCTTGCTA
CCTTCTAGCCAGAACTACTGCAGGCTGATTCCCCCTACACACTCTCTCTGCTCTTCCCAT
GCAAAGCAGAACTCCGTTGCCTCAACGTCCAACCCTTCTGCAGGGCTGCAGTCCGGCCAC
CCCAAGACCTTGCTGCAGGGTGCTTCGGATCCTGATCGTGAGTCGCGGGGTCCACTCCCC
GCCCTTAGCCAGTGCCCAGGGGGCAACAGCGGCGATCGCAACCTCTAGTTTGAGTCAAGG
TCCAGTTTGAATGACCGCTCTCAGCTGGTGAAGACATGACGACCCTGGACTCCAACAACA
ACACAGGTGGCGTCATCACCTACATTGGCTCCAGTGGCTCCTCCCCAAGCCGCACCAGCC
CTGAATCCCTCTATAGTGACAACTCCAATGGCAGCTTCCAGTCCCTGACCCAAGGCTGTC
CCACCTACTTCCCACCATCCCCCACTGGCTCCCTCACCCAAGACCCGGCTCGCTCCTTTG
GGAGCATTCCACCCAGCCTGAGTGATGACGGCTCCCCTTCTTCCTCATCTTCCTCGTCGT
CATCCTCCTCCTCCTTCTATAATGGGAGCCCCCCTGGGAGTCTACAAGTGGCCATGGAGG
ACAGCAGCCGAGTGTCCCCCAGCAAGAGCACCAGCAACATCACCAAGCTGAATGGCATGG
TGTTACTGTGTAAAGTGTGTGGGGACGTTGCCTCGGGCTTCCACTACGGTGTGCACGCCT
GCGAGGGCTGCAAGGGCTTTTTCCGTCGGAGCATCCAGCAGAACATCCAGTACAAAAGGT
GTCTGAAGAATGAGAATTGCTCCATCGTCCGCATCAATCGCAACCGCTGCCAGCAATGTC
GCTTCAAGAAGTGTCTCTCTGTGGGCATGTCTCGAGACGCTGTGCGTTTTGGGCGCATCC
CCAAACGAGAGAAGCAGCGGATGCTTGCTGAGATGCAGAGTGCCATGAACCTGGCCAACA
ACCAGTTGAGCAGCCAGTGCCCGCTGGAGACTtcacccacccagcaccccaccccaggcc
ccatgggcccctcgccaccccctgctccggtcccctcaccccTGGTGGGCTTCTCCCAGT
TTCCACAACAGCTGACGCCTCCCAGATCCCCAAGCCCTGAGCCCACAGTGGAGGATGTGA
TATCCCAGGTGGCCCGGGCCCATCGAGAGATCTTCACCTACGCCCATGACAAGCTGGGCA
GCTCACCTGGCAACTTCAATGCCAACCATGCATCAGGTAGCCCTCCAGCCACCACCCCAC
ATCGCTGGGAAAATCAGGGCTGCCCACCTGCCCCCAATGACAACAACACCTTGGCTGCCC
AGCGTCATAACGAGGCCCTAAATGGTCTGCGCCAGGCTCCCTCCTCCTACCCTCCCACCT
GGCCTCCTGGCCCTGCACACCACAGCTGCCACCAGTCCAACAGCAACGGGCACCGTCTAT
GCCCCACCCACGTGTATGCAGCCCCAGAAGGCAAGGCACCTGCCAACAGTCCCCGGCAGG
GCAACTCAAAGAATGTTCTGCTGGCATGTCCTATGAACATGTACCCGCATGGACGCAGTG
GGCGAACGGTGCAGGAGATCTGGGAGGATTTCTCCATGAGCTTCACGCCCGCTGTGCGGG
AGGTGGTAGAGTTTGCCAAACACATCCCGGGCTTCCGTGACCTTTCTCAGCATGACCAAG
TCACCCTGCTTAAGGCTGGCACCTTTGAGGTGCTGATGGTGCGCTTTGCTTCGTTGTTCA
ACGTGAAGGACCAGACAGTGATGTTCCTAAGCCGCACCACCTACAGCCTGCAGGAGCTTG
GTGCCATGGGCATGGGAGACCTGCTCAGTGCCATGTTCGACTTCAGCGAGAAGCTCAACT
CCCTGGCGCTTACCGAGGAGGAGCTGGGCCTCTTCACCGCGGTGGTGCTTGTCTCTGCAG
ACCGCTCGGGCATGGAGAATTCCGCTTCGGTGGAGCAGCTCCAGGAGACGCTGCTGCGGG
CTCTTCGGGCTCTGGTGCTGAAGAACCGGCCCTTGGAGACTTCCCGCTTCACCAAGCTGC
TGCTCAAGCTGCCGGACCTGCGGACCCTGAACAACATGCATTCCGAGAAGCTGCTGTCCT
TCCGGGTGGACGCCCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTGCCCCCTTGTACAGA
ATCGAACTCTGCACTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAATCTT
ATTTATATTGTTATAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAA
TACCTGcctccctcccccatcaccgaacttcccctcctcccctatttaaaccactctgtc
tcccccACAACCCTCCCCTGGCCCTCTGATTTGTTCTGTTCCTGTCTCAAATCCAATAGT
TCACAGCTGaaaaaaaaaaaaaaaaa