>CR596083 full-length cDNA clone CS0DK010YD06 of HeLa cells Cot 25-normalized of Homo sapiens (human) (2395 bp)
CGCCTCTGCCGGAGGAGCCGCGGGGCCGCCACACTCGccccccgccccccccgcgctcac
tcgcactcacacccgggcgcaggaggcgggcggcccgggccccaccggccccccatggac
gcccccagcacggggcgctgagaccccCGCGTCGCTGCCCAGCCCGGTCCGGCGCGCCAC
GCCGAGGGATCTCTGGACAGGACAAGACTCCGAAGCTACTcccccagcacacagcccggg
acccacaaacccagcttgcccccagccctcccacctgccactccctggcccctcccaccg
cccgcccCCCTTGGGGCGCAGGGCATGGTGTGAAAGGCCAAGTGCTGAGGCGGGTATCAT
GGGTGCTGTGCCCtagggcctgggtggcagggggtgggtggcctgtgggtgtgccggggg
ggccagtgtgCCCACCCCAGTCTCTTGGCGTGCTGGAGGGCATCCTGGATGGAATTGAAG
TGAATGGAACAGAAGCCAAGCAAGGTGGAGTGTGGGTCAGACCCAGAGGAGAACAGTGCC
AGGTCACCAGATGGAAAGCGAAAAAGAAAGAACGGCCAATGTTCCCTGAAAACCAGCATG
TCAGGGTATATCCCTAGTTACCTGGACAAAGACGAGCAGTGTGTCGTGTGTGGGGACAAG
GCAACTGGTTATCACTACCGCTGTATCACTTGTGAGGGCTGCAAGGGCTTCTTTCGCCGC
ACAATCCAGAAGAACCTCCATCCCACCTATTCCTGCAAATATGACAGCTGCTGTGTCATT
GACAAGATCACCCGCAATCAGTGCCAGCTGTGCCGCTTCAAGAAGTGCATCGCCGTGGGC
ATGGCCATGGACTTGGTTCTAGATGACTCGAAGCGGGTGGCCAAGCGTAAGCTGATTGAG
CAGAACCGGGAGCGGCGGCGGAAGGAGGAGATGATCCGATCACTGCAGCAGCGACCAGAG
CCCACTCCTGAAGAGTGGGATCTGATCCACATTGCCACAGAGGCCCATCGCAGCACCAAT
GCCCAGGGCAGCCATTGGAAACAGAGGCGGAAATTCCTGCCCGATGACATTGGCCAGTCA
CCCATTGTCTCCATGCCGGACGGAGACAAGGTGGACCTGGAAGCCTTCAGCGAGTTTACC
AAGATCATCACCCCGGCCATCACCCGTGTGGTGGACTTTGCCAAAAAACTGCCCATGTTC
TCCGAGCTGCCTTGCGAAGACCAGATCATCCTCCTGAAGGGGTGCTGCATGGAGATCATG
TCCCTGCGGGCGGCTGTCCGCTACGACCCTGAGAGCGACACCCTGACGCTGAGTGGGGAG
ATGGCTGTCAAGCGGGAGCAGCTCAAGAATGGCGGCCTGGGCGTAGTCTCCGACGCCATC
TTTGAACTGGGCAAGTCACTCTCTGCCTTTAACCTGGATGACACGGAAGTGGCTCTGCTG
CAGGCTGTGCTGCTAATGTCAACAGACCGCTCGGGCCTGCTGTGTGTGGACAAGATCGAG
AAGAGTCAGGAGGCGTACCTGCTGGCGTTCGAGCACTACGTCAACCACCGCAAACACAAC
ATTCCGCACTTCTGGCCCAAGCTGCTGATGAAGGAGAGAGAAGTGCAGAGTTCGATTCTG
TACAAGGGGGCAGCGGCAGAAGGCCGGCCGGGCGGGTCACTGGGCGTCCACCCGGAAGGA
CAGCAGCTTCTCGGAATGCATGTTGTTCAGGGTCCGCAGGTCCGGCAGCTTGAGCAGCAG
CTTGGTGAAGCGGGAAGTCTCCAAGGGCCGGTTCTTCAGCACCAGAGCCCGAAGAGCCCG
CAGCAGCGTCTCCTGGAGCTGCTCCACCGAAGCGGAATTCTCCATGCCCGAGCGGTCTGT
GGGGAAGACGACAGCAGTGAGGCGGACTCCCCGAGCTCCTCTGAGGAGGAACCGGAGGTC
TGCGAGGACCTGGCAGGCAATGCAGCCTCTCCCTGAAGCCCCCCAGAAGGCCGATGGGGA
AGGAGAAGGAGTGCCATACCTTCTCCCAGGCCTCTGCCCCAAGAGCAGGAGGTGCCTGAA
AGCTGGGAGCGTGGGCTCAGCAGGGCTGGTCACCTCCCATCCCGTAAGACCACCTTCCCT
TCCTCAGCAGGCCAAACATGGCCAGACTCCCTTGCTTTTTGCTGTGTAGTTCCCTCTGCC
TGGGATGCCCTTCCCCCTTTCTCTGCCTGGCAACATCTTACTTGTCCTTTGAGGCCCCAA
CTCAAGTGTCACCTCCTTCCCCAGCTCCCCCAGGCAGAAATAGTTGTCTGTGCTTCCTTG
GTTCATGCTTCTACTGTGACACTTATCTCACTGTTTTATAATTAGTCGGGCATGAGTCTG
TTTCCCAAGCTAGACTGTGTCTGAATCATGTCTGTATCCCCAGTGCCCGGTGCAG