>CR598991 full-length cDNA clone CS0DF037YH17 of Fetal brain of Homo sapiens (human) (1122 bp)
AAAATCAGGGCTGCCCACCTGCCCCCAATGACAACAACACCTTGGCTGCCCAGCGTCATA
ACGAGGCCCTAAATGGTCTGCGCCAGGCTCCCTCCTCCTACCCTCCCACCTGGCCTCCTG
GCCCTGCACACCACAGCTGCCACCAGTCCAACAGCAACGGGCACCGTCTATGCCCCACCC
ACGTGTATGCAGCCCCAGAAGGCAAGGCACCTGCCAACAGTCCCCGGCAGGGCAACTCAA
AGAATGTTCTGCTGGCATGTCCTATGAACATGTACCCGCATGGACGCAGTGGGCGAACGG
TGCAGGAGATCTGGGAGGATTTCTCCATGAGCTTCACGCCCGCTGTGCGGGAGGTGGTAG
AGTTTGCCAAACACATCCCGGGCTTCCGTGACCTTTCTCAGCATGACCAAGTCACCCTGC
TTAAGGCTGGCACCTTTGAGGTGCTGATGGTGCGCTTTGCTTCGTTGTTCAACGTGAAGG
ACCAGACAGTGATGTTCCTAAGCCGCACCACCTACAGCCTGCAGGAGCTTGGTGCCATGG
GCATGGGAGACCTGCTCAGTGCCATGTTCGACTTCAGCGAGAAGCTCAACTCCCTGGCGC
TTACCGAGGAGGAGCTGGGCCTCTTCACCGCGGTGGTGCTTGTCTCTGCAGACCGCTCGG
GCATGGAGAATTCCGCTTCGGTGGAGCAGCTCCAGGAGACGCTGCTGCGGGCTCTTCGGG
CTCTGGTGCTGAAGAACCGGCCCTTGGAGACTTCCCGCTTCACCAAGCTGCTGCTCAAGC
TGCCGGACCTGCGGACCCTGAACAACATGCATTCCGAGAAGCTGCTGTCCTTCCGGGTGG
ACGCCCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTGCCCCCTTGTACAGAATCGAACTC
TGCACTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAATCTTATTTATATT
GTTATAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAATACCTGCCT
CCCTCCCCCATCACCGAACTTCCCCTCCTCCCCTATTTAAACCACTCTGTCTCCCCCACA
ACCCTCCCCTGGCCCTCTGATTTGTTCTGTTCCTGTCTCAAA