>CR608219 full-length cDNA clone CS0DK007YH16 of HeLa cells Cot 25-normalized of Homo sapiens (human) (2734 bp)
GGGCACGAGGCGCTCCCTGGGATCACATGGTACCTGCTCCAGTGCCGCGTGCGGCCCGGG
AACCCTGGGCTGCTGGCGCCTGCGCAGAGCCCTCTGTCCCAGGGAAAGGCTCGGGCAAAA
GGCGGCTGAGATTGGCAGAGTGAAATATTACTGCCGAGGGAACGTAGCAGGGCACACGTC
TCGCCTCTTTGCGACTCGGTGCCCCGTTTCTCCCCATCACCTACTTACTTCCTGGTTGCA
ACCTCTCTTCCTCTGGGACTTTTGCACCGGGAGCTCCAGATTCGCCACCCCGCAGCGCTG
CGGAGCCGGCAGGCAGAGGCACCCCGTACACTGCAGAGACCCGACCCTCCTTGCTACCTT
CTAGCCAGAACTACTGCAGGCTGATTCCCCCTACACACTCTCTCTGCTCTTCCCATGCAA
AGCAGAACTCCGTTGCCTCAACGTCCAACCCTTCTGCAGGGCTGCAGTCCGGCCACCCCA
AGACCTTGCTGCAGGGTGCTTCGGATCCTGATCGTGAGTCGCGGGGTCCACTCCCCGCCC
TTAGCCAGTGCCCAGGGGGCAACAGCGGCGATCGCAACCTCTAGTTTGAGTCAAGGTCCA
GTTTGAATGACCGCTCTCAGCTGGTGAAGACATGACGACCCTGGACTCCAACAACAACAC
AGGTGGCGTCATCACCTACATTGGCTCCAGTGGCTCCTCCCCAAGCCGCACCAGCCCTGA
ATCCCTCTATAGTGACAACTCCAATGGCAGCTTCCAGTCCCTGACCCAAGGCTGTCCCAC
CTACTTCCCACCATCCCCCACTGGCTCCCTCACCCAAGACCCGGCTCGCTCCTTTGGGAG
CATTCCACCCAGCCTGAGTGATGACGGctccccttcttcctcatcttcctcgtcgtcatc
ctcctcctccttcTATAATGGGAGCCCCCCTGGGAGTCTACAAGTGGCCATGGAGGACAG
CAGCCGAGTGTCCCCCAGCAAGAGCACCAGCAACATCACCAAGCTGAATGGCATGGTGTT
ACTGTGTAAAGTGTGTGGGGACGTTGCCTCGGGCTTCCACTACGGTGTGCACGCCTGCGA
GGGCTGCAAGGGCTTTTTCCGTCGGAGCATCCAGCAGAACATCCAGTACAAAAGGTGTCT
GAAGAATGAGAATTGCTCCATCGTCCGCATCAATCGCAACCGCTGCCAGCAATGTCGCTT
CAAGAAGTGTCTCTCTGTGGGCATGTCTCGAGACGCTGTGCGTTTTGGGCGCATCCCCAA
ACGAGAGAAGCAGCGGATGCTTGCTGAGATGCAGAGTGCCATGAACCTGGCCAACAACCA
GTTGAGCAGCCAGTGCCCGCTGGAGACTtcacccacccagcaccccaccccaggccccat
gggcccctcgccacccccTGCTCCGGTCCCCTCACCCCTGGTGGGCTTCTCCCAGTTTCC
ACAACAGCTGACGCCTCCCAGATCCCCAAGCCCTGAGCCCACAGTGGAGGATGTGATATC
CCAGGTGGCCCGGGCCCATCGAGAGATCTTCACCTACGCCCATGACAAGCTGGGCAGCTC
ACCTGGCAACTTCAATGCCAACCATGCATCAGGTAGCCCTCCAGCCACCACCCCACATCG
CTGGGAAAATCAGGGCTGCCCACCTGCCCCCAATGACAACAACACCTTGGCTGCCCAGCG
TCATAACGAGGCCCTAAATGGTCTGCGCCAGGCTCCCTCCTCCTACCCTCCCACCTGGCC
TCCTGGCCCTGCACACCACAGCTGCCACCAGTCCAACAGCAACGGGCACCGTCTATGCCC
CACCCACGTGTATGCAGCCCCAGAAGGCAAGGCACCTGCCAACAGTCCCCGGCAGGGCAA
CTCAAAGAATGTTCTGCTGGCATGTCCTATGAACATGTACCCGCATGGACGCAGTGGGCG
AACGGTGCAGGAGATCTGGGAGGATTTCTCCATGAGCTTCACGCCCGCTGTGCGGGAGGT
GGTAGAGTTTGCCAAACACATCCCGGGCTTCCGTGACCTTTCTCAGCATGACCAAGTCAC
CCTGCTTAAGGCTGGCACCTTTGAGGTGCTGATGGTGCGCTTTGCTTCGTTGTTCAACGT
GAAGGACCAGACAGTGATGTTCCTAAGCCGCACCACCTACAGCCTGCAGGAGCTTGGTGC
CATGGGCATGGGAGACCTGCTCAGTGCCATGTTCGACTTCAGCGAGAAGCTCAACTCCCT
GGCGCTTACCGAGGAGGAGCTGGGCCTCTTCACCGCGGTGGTGCTTGTCTCTGCAGACCG
CTCGGGCATGGAGAATTCCGCTTCGGTGGAGCAGCTCCAGGAGACGCTGCTGCGGGCTCT
TCGGGCTCTGGTGCTGAAGAACCGGCCCTTGGAGACTTCCCGCTTCACCAAGCTGCTGCT
CAAGCTGCCGGACCTGCGGACCCTGAACAACATGCATTCCGAGAAGCTGCTGTCCTTCCG
GGTGGACGCCCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTGCCCCCTTGTACAGAATCG
AACTCTGCACTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAATCTTATTT
ATATTGTTATAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAATACC
TGCCTCCCTCCCCCATCACCGAACTTCCCCTCCTCCCCTATTTAAACCACTCTGTCTCCC
CCACAACCCTCCCCTGGCCCTCTGATTTGTTCTG