>J03239 Human c-erbA-alpha-2 gene encoding thyroid hormone receptor type alpha-2 mRNA, complete cds, clone hTR-alpha-2 (2015 bp)
GTGGCCCACCCCAGTCTCTTGGCGTGCTGGAGGGCATCCTGGATGGAATTGAAGTGAATG
GAACAGAAGCCAAGCAAGGTGGAGTGTGGGTCAGACCCAGAGGAGAACAGTGCCAGGTCA
CCAGATGGAAAGCGAAAAAGAAAGAACGGCCAATGTTCCCTGAAAACCAGCATGTCAGGG
TATATCCCTAGTTACCTGGACAAAGACGAGCAGTGTGTCGTGTGTGGGGACAAGGCAACT
GGTTATCACTACCGCTGTATCACTTGTGAGGGCTGCAAGGGCTTCTTTCGCCGCACAATC
CAGAAGAACCTCCATCCCACCTATTCCTGCAAATATGACAGCTGCTGTGTCATTGACAAG
ATCACCCGCAATCAGTGCCAGCTGTGCCGCTTCAAGAAGTGCATCGCCGTGGGCATGGCC
ATGGACTTGGTTCTAGATGACTCGAAGCGGGTGGCCAAGCGTAAGCTGATTGAGCAGAAC
CGGGAGCGGCGGCGGAAGGAGGAGATGATCCGATCACTGCAGCAGCGACCAGAGCCCACT
CCTGAAGAGTGGGATCTGATCCACATTGCCACAGAGGCCCATCGCAGCACCAATGCCCAG
GGCAGCCATTGGAAACAGAGGCGGAAATTCCTGCCCGATGACATTGGCCAGTCACCCATT
GTCTCCATGCCGGACGGAGACAAGGTGGACCTGGAAGCCTTCAGCGAGTTTACCAAGATC
ATCACCCCGGCCATCACCCGTGTGGTGGACTTTGCCAAAAAACTGCCCATGTTCTCCGAG
CTGCCTTGCGAAGACCAGATCATCCTCCTGAAGGGGTGCTGCATGGAGATCATGTCCCTG
CGGGCGGCTGTCCGCTACGACCCTGAGAGCGACACCCTGACGCTGAGTGGGGAGATGGCT
GTCAAGCGGGAGCAGCTCAAGAATGGCGGCCTGGGCGTAGTCTCCGACGCCATCTTTGAA
CTGGGCAAGTCACTCTCTGCCTTTAACCTGGATGACACGGAAGTGGCTCTGCTGCAGGCT
GTGCTGCTAATGTCAACAGACCGCTCGGGCCTGCTGTGTGTGGACAAGATCGAGAAGAGT
CAGGAGGCGTACCTGCTGGCGTTCGAGCACTACGTCAACCACCGCAAACACAACATTCCG
CACTTCTGGCCCAAGCTGCTGATGAAGGAGAGAGAAGTGCAGAGTTCGATTCTGTACAAG
GGGGCAGCGGCAGAAGGCCGGCCGGGCGGGTCACTGGGCGTCCACCCGGAAGGACAGCAG
CTTCTCGGAATGCATGTTGTTCAGGGTCCGCAGGTCCGGCAGCTTGAGCAGCAGCTTGGT
GAAGCGGGAAGTCTCCAAGGGCCGGTTCTTCAGCACCAGAGCCCGAAGAGCCCGCAGCAG
CGTCTCCTGGAGCTGCTCCACCGAAGCGGAATTCTCCATGCCCGAGCGGTCTGTGGGGAA
GACGACAGCAGTGAGGCGGACTCCCCGAGCTCCTCTGAGGAGGAACCGGAGGTCTGCGAG
GACCTGGCAGGCAATGCAGCCTCTCCCTGAAGCCCCCCAGAAGGCCGATGGGGAAGGAGA
AGGAGTGCCATACCTTCTCCCAGGCCTCTGCCCCAAGAGCAGGAGGTGCCTGAAAGCTGG
GAGCGTGGGCTCAGCAGGGCTGGTCACCTCCCATCCCGTAAGACCTCCTTCCCTTCCTCA
GCAGGCCAAACATGGCCAGACTCCTTGCTTTTTGCTGTGTAGTTCCCTCTGCCTGGGATG
CCCTTCCCCCTTTCTCTGCCTGGCAACATCTTACTTGTCCTTTGAGGCCCCAACTCAAGT
GTGCACCTCCTTCCCCAGCTCCCCCAGGCAGAAAATAGTTGTCTGTGCTTCCTTGGTTCA
TGCTTCTACTGTGACACTTATCTCAGCTGTTTTATAATTAGTCGGGCATGAGTCTGTTTC
CCAAGCTAGACTGTGTCTGAATCATGTCTGTATCCCCAGTGCCCGGTGCAGGGCCTGGCA
TAGAGTAGGTACTCCATAAAAGGTGTGTTGAATTG