>M24900 Human triiodothyronine recptor (THRA1, ear1), and ear2 genes, last 2 exons each (2054 bp)
GGATCCCAAAGCCATCCTTCCACCTGGGCTCCCTCATTGGCCATTCAGAAACAACCCCCA
CTCTACTGAGAAATCGAAGGCAGCACCGCTAAACCCTCTGGCAAACTACAGGGGCGATTT
GGTCAGTGCTCCTCCCACCACACCCAGGATGACTGTTCCCCTTCCCTCCTAGGTGCTGAT
GGTGCGCTTTGCTTCGTTGTTCAACGTGAAGGACCAGACAGTGATGTTCCTAAGCCGCAC
CACCTACAGCCTGCAGGAGCTTGGTGCCATGGGCATGGGAGACCTGCTCAGTGCCATGTT
CGACTTCAGCGAGAAGCTCAACTCCCTGGCGCTTACCGAGGAGGAGCTGGGCCTCTTCAC
CGCGGTGGTGCTTGTCTCTGCAGGTAGGTCAGGCTCTCGCCTGACCGGGGGAGGAGGCAG
ACGCAGTTCAATTCAACACACCTTTTATGGAGTACCTACTCTATGCCAGGCCCTGCACCG
GGCACTGGGGATACAGACATGATTCAGACACAGTCTAGCTTGGGAAACAGACTCATGCCC
GACTAATTATAAAACAGTGAGATAAGTGTCACAGTAGAAGCATGAACCAAGGAAGCACAG
ACAACTATTTCTGCCTGGGGGAGCTGGGGAAGGAGGTGACACTTGAGTTGGGGCCTCAAA
GGACAAGTAAGATGTTGCCAGGCAGAGAAAGGGGGAAGGGCATCCCAGGCAGAGGGAACT
ACACAGCAAAAAGCAAGGGAGTCTGGCCATGTTTGGCCTGCTGAGGAAGGGAAGGTGGTC
TTACGGGATGGGAGGTGACCAGCCCTGCTGAGCCCACGCTCCCAGCTTTCAGGCACCTCC
TGCTCTTGGGGCAGAGGCCTGGGAGAAGGTATGGCACTCCTTCTCCTTCCCCATCGGCCT
TCTGGGGGGCTTCAGGGAGAGGCTGCATTGCCTGCCAGGTCCTCGCAGACCTCCGGTTCC
TCCTCAGAGGAGCTCGGGGAGTCCGCCTCACTGCTGTCGTCTTCCCCACAGACCGCTCGG
GCATGGAGAATTCCGCTTCGGTGGAGCAGCTCCAGGAGACGCTGCTGCGGGCTCTTCGGG
CTCTGGTGCTGAAGAACCGGCCCTTGGAGACTTCCCGCTTCACCAAGCTGCTGCTCAAGC
TGCCGGACCTGCGGACCCTGAACAACATGCATTCCGAGAAGCTGCTGTCCTTCCGGGTGG
ACGCCCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTGCCCCCTTGTACAGAATCGAACTC
TGCACTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAATCTTATTTATATT
GTTATAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAATACCTGcct
ccctcccccatcaccgaacttcccctcctcccctatttaaaccactctgtctcccccACA
ACCCTCCCCTGGCCCTCTGATTTGTTCTGTTCCTGTCTCAAATCCAATAGTTCACAGCTG
AGCTGGCTTCTGTGGTGTGTAGCGACCCGGGGGGTGGGGTGGAAATACTGCCAAGGCTgg
ggggggCCACCTCTCCATCTGGTCAGTTTGTGGGGTGGGTACTCTGCCAGCAGATGGGAG
GATATAGGGAAACAGCACACAAGTCTAAGGGGGGTGCCCAAGGGGGTTATTTTCATCATA
TATTTATTACATAAATATATAGTAAAATAGACGAGCAACAATTACCATAAAAATATCTTT
CTTTAAAATCCTGACCCAAAACACAACGGGGTGTTCTCTCCAGGCTCCTCCCCACACTCC
GCACACCCTCTGGCCGCCTGAGGCTTTAGACTTCCTGATCCTCAAAGACCTCGAGGAAGA
GTGGGGGGAAGAGTTCGGTGGGGCACTCGACTTTCATGTGGAGGAAGCGGCTGGCGTGGC
AGGCCCCGATCATGCGGAGGTCAGTCACCTTCATCAGCAGCTTGGGCCAGAAGTGCGGAA
TGTTGTGTTTGCGGTGGTTGACGTAGTGCTCGAACGCCAGCAGGTACGCCTCCTGACTCT
TCTCGATCTTGTCC