>NM_003684 Homo sapiens MAP kinase interacting serine (2736 bp)
GCGACCGCTCCCCGGCGGGAGCCAGCGAAGGTTTCCATGTCAGAGGCCGATGGAGAACTG
AAGATTGCCACCTACGCACAAAGGCCATTGAGACACTTCGTGTAGCTGGAAGACACCAAC
TTCCTGACAGGAGCTTTATTTCATTTGGGATTTCAAGTTTACAGATGGTATCTTCTCAAA
AGTTGGAAAAACCTATAGAGATGGGCAGTAGCGAACCCCTTCCCATCGCAGATGGTGACA
GGAGGAGGAAGAAGAAGCGGAGGGGCCGGGCCACTGACTCCTTGCCAGGAAAGTTTGAAG
ATATGTACAAGCTGACCTCTGAATTGCTTGGAGAGGGAGCCTATGCCAAAGTTCAAGGTG
CCGTGAGCCTACAGAATGGCAAAGAGTATGCCGTCAAAATCATCGAGAAACAAGCAGGGC
ACAGTCGGAGTAGGGTGTTTCGAGAGGTGGAGACGCTGTATCAGTGTCAGGGAAACAAGA
ACATTTTGGAGCTGATTGAGTTCTTTGAAGATGACACAAGGTTTTACTTGGTCTTTGAGA
AATTGCAAGGAGGTTCCATCTTAGCCCACATCCAGAAGCAAAAGCACTTCAATGAGCGAG
AAGCCAGCCGAGTGGTGCGGGACGTTGCTGCTGCCCTTGACTTCCTGCATACCAAagaca
aagtctctctctgtcacctaggctggagtgctatggcgccatcagggctcactgcagccc
caacctccctgggctccagtgatcctcccacctcagcctcccaagtagctgggactacag
gcaTTGCTCATCGTGATCTGAAACCAGAAAATATATTGTGTGAATCTCCAGAAAAGGTGT
CTCCAGTGAAAATCTGTGACTTTGACTTGGGCAGTGGGATGAAACTGAACAACTCCTGTA
CCCCCATAACCACACCAGAGCTGACCACCCCATGTGGCTCTGCAGAATACATGGCCCCTG
AGGTAGTGGAGGTCTTCACGGACCAGGCCACATTCTACGACAAGCGCTGTGACCTGTGGA
GCCTGGGCGTGGTCCTCTACATCATGCTGAGTGGCTACCCACCCTTCGTGGGTCACTGCG
GGGCCGACTGTGGCTGGGACCGGGGCGAGGTCTGCAGGGTGTGCCAGAACAAGCTGTTTG
AAAGCATCCAGGAAGGCAAGTATGAGTTTCCTGACAAGGACTGGGCACACATCTCCAGTG
AAGCCAAAGACCTCATCTCCAAGCTCCTGGTGCGAGATGCAAAGCAGAGACTTAGCGCCG
CCCAAGTTCTGCAGCACCCATGGGTGCAGGGGCAAGCTCCAGAAAAGGGACTCCCCACGC
CGCAAGTCCTCCAGAGGAACAGCAGCACAATGGACCTGACGCTCTTCGCAGCTGAGGCCA
TCGCCCTTAACCGCCAGCTATCTCAGCACGAAGAGAACGAACTAGCAGAGGAGCCAGAGG
CACTAGCTGATGGCCTCTGCTCCATGAAGCTTTCCCCTCCCTGCAAGTCACGCCTGGCCC
GGAGACGGGCCCTGGCCCAGGCAGGCCGTGGTGAAGACAGGAGCCCGCCCACAGCACTCT
GAAATGCTCCAGTCACACCTTATAGGCCCTAGGCCTGGCCAGGCATTGTCCCCTGGAAAC
CTGTGTGGCTAAAGTCTGCTGAGCAGGCAGCAGCCTCTGCTCTGTGGCTCCATTCAGGCT
TTTTCATCTACGAAGGCCCTGAGGTTCCCATCAACCCCCATTTCCCTAGGGTCCTGGAGG
AAAAAGCTTTTTCCAAAGGGGTTGTCTTTGAAAAGGAAAGCAATCACTTCTCACTTTGCA
TAATTGCCTGCAGCAGGAACATCTCTTCACTGGGCTCCACCTGCTCACCCGCCTGCAGAT
CTGGGATCCAGCCTGCTCTCACCGCTGTAGCTGTGGCGGCTGGGGCTGCAGCCTGCAGGG
AGAAGCAAGAAGCATCAGTTGACAGAGGCTGCCGACACGTGcctcttccctctcttctct
gtcaccctcctctggcggtccttccaccttcctctgTCCTCCGGATGTCCTCTTTGCCCG
TCTTCTCCCTTGGCTGAGCAAAGCCATCCCCTCAATTCAGGGAAGGGCAAGGAGCCTTCC
TCATTCAGGAAATCAAATCAGTCTTCCGGTCTGCAGCACGGAAAAGCACATAATCTTTCT
TTGCTGTGACTGAAATGTATCCCTCGTTTATCATCCCCTTTGTTTGTGATTGCTGCTAAA
GTCAGTAGTATCGTTTTTTTaaaaaaaaaGTTTGGTGTTTTTAACCATGCTGTTCCAGCA
AAGATGATACCTTAAACTCCCACTGCAAGCCCATGAACTTCCCAGAGAGTGGAACGGCTT
GCTCTTCTTTCTAGAATGTCCATGCACTTGGGTTTTAATCAGCAGTTCCCTATTATTCTG
ATTTTAAGCTGTTCCTGTGATGAACTTAGAGACAGCATCGGTGTCTGCTGCTGTGTCCCC
AGGTCTTGTGTGGGTGGCACAGATCTGGGCAGTTAGATAGTGCTCTGTGCCTAAGGTGAA
GCCACACTAGGGTGAAGCCTCACTTCCCTGTTTGAGCAATGCAGTGCCTGCTGCCCGTGT
GCATGAAGGTACAGCCATTCAGATAAGTGGAACTATTGAGTTACATAAAGAAAATAGATT
TGCATTTGTCAGGCAGACGTTTATACAACACCACGGTGCTTTTATACATTGTGCTTATTT
TAATAAAACTGAAATTCTaaaaaaaaaaaaaaaaaa