>NM_004284 Homo sapiens chromodomain helicase DNA binding protein 1-like (CHD1L), mRNA (2980 bp)
GCGGGGCCTCTACCGGCCCGATGGAGCGCGCGGGCGCTACTAGCCGCGGGGGCCAAGCCC
CTGGCTTCTTACTGCGGCTTCATACTGAGGGCCGAGCCGAGGCGGCGCGGGTGCAGGAGC
AGGACTTACGGCAGTGGGGGCTGACAGGGATTCACCTACGCTCTTACCAGCTGGAGGGAG
TAAACTGGCTCGCCCAGCGCTTCCATTGTCAGAATGGCTGTATCCTGGGAGATGAGATGG
GCCTGGGGAAGACCTGCCAGACTATTGCTCTCTTCATTTATTTGGCAGGAAGATTAAATG
ATGAAGGGCCATTTCTGATTCTTTGTCCCTTGTCTGTTTTGAGCAACTGGAAAGAAGAAA
TGCAGAGATTTGCTCCAGGTCTTTCCTGTGTAACATATGCAGGCGACAAGGAGGAAAGAG
CCTGCCTTCAGCAAGACCTGAAACAGGAGTCACGTTTTCATGTGCTACTGACTACCTATG
AGATTTGCTTGAAAGATGCATCATTTCTAAAATCATTCCCTTGGAGTGTTCTTGTTGTGG
ATGAAGCTCACAGGTTGAAAAACCAAAGCTCCCTGCTGCATAAGACCTTGTCAGAGTTCT
CAGTAGTCTTCAGTCTCCTGTTGACCGGAACTCCCATCCAGAACAGCCTCCAAGAGCTCT
ACTCCCTCCTCAGTTTTGTGGAGCCTGATCTCTTTTCCAAGGAAGAGGTGGGAGATTTTA
TTCAACGCTACCAGGATATTGAGAAAGAATCTGAGTCAGCAAGTGAACTGCACAAACTCT
TGCAGCCATTTCTGCTGAGGCGAGTGAAAGCTGAGGTAGCTACAGAGCTTCCCAAGAAGA
CAGAAGTAGTGATATACCATGGCATGTCAGCATTGCAGAAGAAATACTACAAGGCCATTT
TGATGAAAGACCTAGATGCATTTGAAAATGAGACGGCAAAGAAGGTTAAACTACAGAACA
TTTTGTCCCAGCTTCGAAAGTGTGTGGATCACCCATATTTGTTTGATGGTGTGGAGCCGG
AGCCTTTTGAAGTTGGAGACCACCTGACTGAGGCTAGTGGGAAGCTTCACCTGCTGGATA
AGCTACTAGCATTCCTGTATTCTGGGGGCCATCGGGTTTTACTTTTCTCCCAAATGACCC
AGATGTTGGATATTCTCCAAGACTATATGGATTACAGAGGCTACAGCTATGAGCGTGTGG
ATGGTTCTGTGAGAGGAGAAGAGAGACACTTGGCCATTAAGAACTTTGGACAGCAGCCCA
TTTTCGTTTTTCTCCTGAGTACTAGGGCAGGTGGAGTTGGCATGAACTTAACAGCAGCAG
ATACTGTGATTTTTGTTGACAGTGACTTTAATCCTCAGAATGACTTGCAAGCAGCTGCCA
GGGCTCATCGCATTGGCCAAAACAAGTCTGTTAAAGTTATTCGGCTGATTGGTCGAGACA
CTGTGGAAGAAATAGTCTATAGGAAAGCAGCCTCCAAACTGCAGCTCACCAACATGATCA
TAGAAGGAGGCCATTTTACTCTGGGAGCCCAGAAACCCGCTGCCGATGCTGACCTCCAGT
TGAGTGAGATACTCAAATTTGGTTTGGATAAACTGCTGGCCTCTGAGGGGAGCACCATGG
ATGAAATAGACCTGGAGTCCATCCTGGGAGAAACAAAAGATGGCCAGTGGGTCTCTGATG
CCTTGCCTGCAGCAGAAGGAGGGAGCAGAGATCAAGAGGAAGGAAAAAATCATATGTACT
TATTTGAAGGTAAAGATTATTCTAAAGAGCCCAGTAAGGAAGACAGAAAATCATTTGAAC
AACTGGTAAACCTTCAGAAAACCCTTTTGGAGAAAGCTAGTCAAGAGGGCCGATCACTCC
GAAATAAAGGCAGTGTTCTCATCCCAGGCCTTGTGGAGGGATCTACCAAAAGGAAGCGGG
TTCTGAGTCCAGAAGAGCTGGAGGACAGACAGaagaaaagacaagaagcagctgccaaga
gaaggagactcatagaggagaagaagaggcaaaaggAAGAGGCTGAACATAAGAAAAAGA
TGGCCTGGTGGGAATCCAACAATTACCAGTCCTTCTGCCTGCCCTCTGAGGAGAGCGAGC
CAGAGGACCTTGAGAATGGGGAAGAGAGCTCTGCTGAGCTGGATTACCAAGACCCAGATG
CTACTTCCCTCAAGTACGTTAGTGGTGATGTCACCCACCCTCAGGCTGGGGCCGAGGATG
CTCTCATTGTGCACTGCGTAGATGACTCTGGCCACTGGGGCAGAGGTGGTTTATTTACAG
CTCTGGAAAAGCGATCCGCTGAGCCAAGAAAAATATATGAGCTGGCTGGGAAAATGAAAG
ACCTGAGTTTGGGAGGTGTCCTTTTATTTCCTGTTGATGATAAAGAATCAAGAAACAAAG
GGCAAGATTTGTTGGCCTTGATTGTGGCTCAGCATCGTGATCGTTCCAATGTCCTGTCTG
GCATTAAGATGGCAGCCCTAGAAGAGGGCCTGAAGAAGATATTTTTAGCAGCAAAAAAGA
AGAAAGCAAGTGTTCATCTTCCACGTATTGGACATGCCACGAAAGGTTTTAACTGGTATG
GTACTGAGCGACTTATTCGGAAACATCTGGCTGCAAGAGGCATCCCAACTTACATATATT
ATTTTCCTAGAAGCAAGTCTGCTGTCCTTCATTCACAGTCTTCATCTTCCTCCTCAAGAC
AGCTGGTGCCTTAAGAATTGGCCCAGCCTCAGATCCTGTCTTTAGCAACCAGCTAATATT
TACCCAGAGGTACTGCAATAGAGTATTTCAAAATGGAATCAGGATCTGGTGGGCCTCAGA
AATTGTCTCTTTTCTGAGTTTCAGTTTGGTTCTCCTGGATGTTTTGCTCTGTTTTGATAC
CTGTAATATAGGGAAACACAACTTTTTTTGGGAAAGCCCTTTGACCCCAGCTTGCTAGTT
GCATAATAATAAATTTTCTGTTCCTaaaaaaaaaaaaaaa