>NM_021724 Homo sapiens nuclear receptor subfamily 1, group D, member 1 (NR1D1), mRNA (2768 bp)
CCGAGGCGCTCCCTGGGATCACATGGTACCTGCTCCAGTGCCGCGTGCGGCCCGGGAACC
CTGGGCTGCTGGCGCCTGCGCAGAGCCCTCTGTCCCAGGGAAAGGCTCGGGCAAAAGGCG
GCTGAGATTGGCAGAGTGAAATATTACTGCCGAGGGAACGTAGCAGGGCACACGTCTCGC
CTCTTTGCGACTCGGTGCCCCGTTTCTCCCCATCACCTACTTACTTCCTGGTTGCAACCT
CTCTTCCTCTGGGACTTTTGCACCGGGAGCTCCAGATTCGCTACCCCGCAGCGCTGCGGA
GCCGGCAGGCAGAGGCACCCCGTACACTGCAGAGACCCGACCCTCCTTGCTACCTTCTAG
CCAGAACTACTGCAGGCTGATTCCCCCTACACACTCTCTCTGCTCTTCCCATGCAAAGCA
GAACTCCGTTGCCTCAACGTCCAACCCTTCTGCAGGGCTGCAGTCCGGCCACCCCAAGAC
CTTGCTGCAGGGTGCTTCGGATCCTGATCGTGAGTCGCGGGGTCCACTCCCCGCCCTTAG
CCAGTGCCCAGGGGGCAACAGCGGCGATCGCAACCTCTAGTTTGAGTCAAGGTCCAGTTT
GAATGACCGCTCTCAGCTGGTGAAGACATGACGACCCTGGACTCCAACAACAACACAGGT
GGCGTCATCACCTACATTGGCTCCAGTGGCTCCTCCCCAAGCCGCACCAGCCCTGAATCC
CTCTATAGTGACAACTCCAATGGCAGCTTCCAGTCCCTGACCCAAGGCTGTCCCACCTAC
TTCCCACCATCCCCCACTGGCTCCCTCACCCAAGACCCGGCTCGCTCCTTTGGGAGCATT
CCACCCAGCCTGAGTGATGACGGCTCCCCTTCTTCCTCATCTTCCTCGTCGTCATCCTCC
TCCTCCTTCTATAATGGGAGCCCCCCTGGGAGTCTACAAGTGGCCATGGAGGACAGCAGC
CGAGTGTCCCCCAGCAAGAGCACCAGCAACATCACCAAGCTGAATGGCATGGTGTTACTG
TGTAAAGTGTGTGGGGACGTTGCCTCGGGCTTCCACTACGGTGTGCACGCCTGCGAGGGC
TGCAAGGGCTTTTTCCGTCGGAGCATCCAGCAGAACATCCAGTACAAAAGGTGTCTGAAG
AATGAGAATTGCTCCATCGTCCGCATCAATCGCAACCGCTGCCAGCAATGTCGCTTCAAG
AAGTGTCTCTCTGTGGGCATGTCTCGAGACGCTGTGCGTTTTGGGCGCATCCCCAAACGA
GAGAAGCAGCGGATGCTTGCTGAGATGCAGAGTGCCATGAACCTGGCCAACAACCAGTTG
AGCAGCCAGTGCCCGCTGGAGACTtcacccacccagcaccccaccccaggccccatgggc
ccctcgccacccccTGCTCCGGTCCCCTCACCCCTGGTGGGCTTCTCCCAGTTTCCACAA
CAGCTGACGCCTCCCAGATCCCCAAGCCCTGAGCCCACAGTGGAGGATGTGATATCCCAG
GTGGCCCGGGCCCATCGAGAGATCTTCACCTACGCCCATGACAAGCTGGGCAGCTCACCT
GGCAACTTCAATGCCAACCATGCATCAGGTAGCCCTCCAGCCACCACCCCACATCGCTGG
GAAAATCAGGGCTGCCCACCTGCCCCCAATGACAACAACACCTTGGCTGCCCAGCGTCAT
AACGAGGCCCTAAATGGTCTGCGCCAGGCTCCCTCCTCCTACCCTCCCACCTGGCCTCCT
GGCCCTGCACACCACAGCTGCCACCAGTCCAACAGCAACGGGCACCGTCTATGCCCCACC
CACGTGTATGCAGCCCCAGAAGGCAAGGCACCTGCCAACAGTCCCCGGCAGGGCAACTCA
AAGAATGTTCTGCTGGCATGTCCTATGAACATGTACCCGCATGGACGCAGTGGGCGAACG
GTGCAGGAGATCTGGGAGGATTTCTCCATGAGCTTCACGCCCGCTGTGCGGGAGGTGGTA
GAGTTTGCCAAACACATCCCGGGCTTCCGTGACCTTTCTCAGCATGACCAAGTCACCCTG
CTTAAGGCTGGCACCTTTGAGGTGCTGATGGTGCGCTTTGCTTCGTTGTTCAACGTGAAG
GACCAGACAGTGATGTTCCTAAGCCGCACCACCTACAGCCTGCAGGAGCTTGGTGCCATG
GGCATGGGAGACCTGCTCAGTGCCATGTTCGACTTCAGCGAGAAGCTCAACTCCCTGGCG
CTTACCGAGGAGGAGCTGGGCCTCTTCACCGCGGTGGTGCTTGTCTCTGCAGACCGCTCG
GGCATGGAGAATTCCGCTTCGGTGGAGCAGCTCCAGGAGACGCTGCTGCGGGCTCTTCGG
GCTCTGGTGCTGAAGAACCGGCCCTTGGAGACTTCCCGCTTCACCAAGCTGCTGCTCAAG
CTGCCGGACCTGCGGACCCTGAACAACATGCATTCCGAGAAGCTGCTGTCCTTCCGGGTG
GACGCCCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTGCCCCCTTGTACAGAATCGAACT
CTGCACTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAATCTTATTTATAT
TGTTATAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAATACCTGCC
TCCCTCCCCCATCACCGAACTtcccctcctcccctatttaaaccactctgtctcccccac
aaccctcccctggccctcTGATTTGTTCTGTTCCTGTCTCAAATCCAATAGTTCACAGCT
GAGCTGGG