>NM_033261 Homo sapiens isopentenyl-diphosphate delta isomerase 2 (IDI2), mRNA (1359 bp)
GAGTTCCACATCTGATACCCAGGAGTCTCCAGCTTCCAAGAGAGGTCGGGTCACAGCCAG
CAGCTATGTCTGACATAAATCTTGACTGGGTTGACAGGCGTCAGTTGCAGCGCTTGGAGG
AAATGCTGATTGTTGTGGATGAGAATGATAAGGTTATTGGTGCCGACACCAAGAGGAATT
GCCATCTGAACGAAAACATTGAGAAAGGGCTGCTGCACCGAGCCTTCAGCGTTGTCTTGT
TTAACACCAAGAATCGAATCCTGATACAGCAGAGGTCGGACACGAAAGTCACGTTTCCTG
GGTATTTTACCGACTCCTGTAGTAGCCACCCATTATACAACCCAGCAGAACTGGAAGAAA
AGGATGCCATCGGAGTGAGGAGGGCAGCCCAGAGGCGTCTGCAAGCAGAGCTGGGAATTC
CTGGGGAGCAGATTTCTCCAGAGGACATTGTGTTCATGACAATCTATCACCACAAGGCAA
AATCAGACAGAATTTGGGGAGAGCATGAAATTTGTTACCTTCTGCTTGTGAGGAAAAACG
TCACTCTGAACCCGGATCCCAGTGAAACGAAAAGCATCCTCTACCTGTCCCAGGAGGAGC
TGTGGGAGCTGCTGGAGAGGGAGGCGAGGGGTGAAGTCAAAGTCACCCCCTGGCTAAGAA
CCATTGCCGAGAGGTTTCTGTACCGGTGGTGGCCTCACCTGGATGACGTGACCCCGTTTG
TGGAGCTTCACAAAATACACAGAGTGTGAGAGGCAGGGAGGTCGAGTCAGCCATGTGTAA
TGCCCTCAGTGCAGGCAGACGCACCATTGAGGCAATGATACACCCTCTCCAAAAAACAGG
GCAAAAGGGGCACTTGATTGCCCATCATGTATAAATCACTATTTCAACCTTTTCATCAAC
TTTGTCATATCTTCATTTTCCCTTTTCCTTATTTCCATATTTCTCATCTGCCTGGTTGCA
GGGAGGAAATTTAACATTTCCTTTGTCCCAATTTCCATTTTATAAGCACTTGTTTGATTA
ACAGCAGCTGATCCTGAAAGTCTTGGGGAGATCTTGAGAGTCCTGAAGCAGGCAGACTAG
CCTGGCTGGACCATGAGGCTGTCTCCCCACAGCTTTATCCAAGCCTCCAAGGTCAGGATG
GGATCTCTGTATCATGTTTTTCTTTTTAAATCACTTATTTCAGAGTGCAACACAAGGCTG
CATTTTTaaaaaaaaGACACATTCAATCTTGCATCCTAATACAAGCAGTACGGAAGATGC
GTATGGTCTCAGCCAAGTGACTCGACGTTTATCCACTTCTGTTCATTTGATCGTTTCAGT
AATATGCTTACAAATAAAGACATACTTGCTTTAAAACAT