>NM_181809 Homo sapiens bone morphogenetic protein 8a (BMP8A), mRNA (5626 bp)
GGTCGCTGCCGGAGCTCGCCGGTCGCCCCTGCGCTGCGCGGACCGCAGCCACAGCCGGAC
TGGTGGGAACGGCGGCGACAGACGGATTGGCTGACAGTCCCAGCCCTCAGAACAGCCCCG
GCCTCGAAGCGTTGGCGTCTGCGTCCGCGTCAGCGTCCGCTTGTCCCGGAGCCGGGGCAG
GTGCGCGCGGGGGGCGCTCCAGGgaccgcgctgaggccgcagacgccgcccgccgagccc
cgccccctgctcgccgAACTCAGCTCCCCGTTCGCCGTCGGGGCGTCCCCGGGCCCAGGG
GCGGCGGCGGAGCTGATGTGcgcccgctgagcgcccccggcccgccatggccgcgcgccc
cgGACCGCTCTGGCTTCTGGGCCTGACGTTGTGCGCGCTGGGCGGGGGCGGCCCCGGCCT
GCGACCCCCGCCCGGCTGTCCCCAGCGACGTCTGGGCGCGCGCGAGCGCCGGGACGTGCA
GCGCGAGATCCTGGCGGTGCTCGGGCTACCCGggcggccccggccccgcgcgccacccgc
cgcctcccggctgcccgcgtccgcgccgcTCTTCATGCTGGACCTGTACCACGCCATGGC
TGGCGACGACGACGAGGACGGCGCGCCCGCGGAGCAGCGCCTGGGCCGCGCCGACCTGGT
CATGAGCTTCGTCAACATGGTGGAGCGAGACCGTGCCCTGGGCCACCAGGAGCCCCATTG
GAAGGAGTTCCGCTTTGACCTGACCCAGATCCCGGCTGGGGAGGCGGTCACAGCTGCGGA
GTTCCGGATTTACAAGGTGCCCAGCATCCACCTGCTCAACAGGACCCTCCACGTCAGCAT
GTTCCAGGTGGTCCAGGAGCAGTCCAACAGGGAGTCTGACTTGTTCTTTTTGGATCTTCA
GACGCTCCGAGCTGGAGACGAGGGCTGGCTGGTGCTGGATGTCACAGCAGCCAGTGACTG
CTGGTTGCTGAAGCGTCACAAGGACCTGGGACTCCGCCTCTATGTGGAGACTGAGGATGG
GCACAGCGTGGATCCTGGCCTGGCCGGCCTGCTGGGTCAACGGGCCCCACGCTCCCAACA
GCCTTTCGTGGTCACTTTCTTCAGGGCCAGTCCGAGTCCCATCCGCACCCCTCGGGCAGT
GAGGCCACTGAGGAGGAGGCAGCCGAAGAAAAGCAACGAGCTGCCGCAGGCCAACCGACT
CCCAGGGATCTTTGATGACGTCCACGGCTCCCACGGCCGGCAGGTCTGCCGTCGGCACGA
GCTCTACGTCAGCTTCCAGGACCTTGGCTGGCTGGACTGGGTCATCGCCCCCCAAGGCTA
CTCAGCCTATTACTGTGAGGGGGAGTGCTCCTTCCCGCTGGACTCCTGCATGAACGCCAC
CAACCACGCCATCCTGCAGTCCCTGGTGCACCTGATGAAGCCAAACGCAGTCCCCAAGGC
GTGCTGTGCACCCACCAAGCTGAGCGCCACCTCTGTGCTCTACTATGACAGCAGCAACAA
CGTCATCCTGCGCAAGCACCGCAACATGGTGGTCAAGGCCTGCGGCTGCCACTGAGTCAG
CCCGCCCAGCCCTACTGCAGCCACCCTTCTCATCTGGATCGGGCCCTGCAGAGGCAGAAA
ACCCTTAAATGCTGTCACAGCTCAAGCAGGAGTGTCAGGGGCCCTCACTCTCGGTGCCTA
CTTCCTGTCAGGCTTCTGGTCCTTTCTCGGTACCTCTGTGCCCCTCCCCTGGGGTTTGTG
GCTGTCACTCTGCCCGACACTTTGGTGGCCTAAGGCACACAGCAGCCTCAGAGCCTGTGC
TGACTGCACTGTCTGGAGTCAGCACAGAAGTCCTATCTTAGGACCTGTCAGACTGTGGCT
GGCCCCGGATGGTCTGAGGTTGGCTGACCCGAGCTTTTCTCCATTCACCAGAGGGTTTAG
GTGTGAGGAGAAGGGCTCTGCCTCTTCCCAGGTACAACACTGGCCATTTCTGGGCAAAAT
TGGACACGCTTATGTTCTCAGCACAGTGTGTTCTGGGATTCTTCTCATTTGGTCCAGGGT
GCAGTTAGCATATTAGAAAAAGAATAAGCTGGACATCCCCACGAAGCCACTGGGGAtttt
ttttttttttttCCagatagagtctcactctgtcacccaggctggagtgcagtggtgcaa
tcctggctcactgcaacctctgcctcccaggttcaagcaattctcgtgcctcagcctcct
gagtagctgggattacaggggcccaccaccacgcccagctcattcttgtatttttagtag
agacggggtttcaccatatcggccaggctggtcttgaactcctgacctcaggtgatccac
ccgcccggcctcccaaagtgttgggatgacaggcatgagccaccgtgcctggccACTGGG
GATATTTTATGTCATGTGTATTCCCTTGCCCTGGGCCTGCCCCTTCTCCTGCCTGGGAAA
GAGGTATGACTCCCACAGGAGCAAAGAATCCTGGGGGCTTCCAGTTCCCTCCACCATCTC
TACCATGCTGACCCATTTGGGGCTCAGCACTGAGACAGAGGCAAGACCAGCAGCTCCAAC
ATGTAGTGTAGGCTGGCACAGAGCAAATGCCCCCGCAGCCTGCTCCCCTTGCCCATGGCT
CATGTCAGTAATCAACCTACGTACCTTTCCCACTGAACCAGGACAGGGCCTCCAGGCCTC
AGCACAGAACTGCAGACAGCCACCACCAGGCATTGTCAATAAGACCTCAGTTCCCCCTCC
TGCCCCACTGCAGAGCAATCCATTCCATCCAAAGCAGGGTGACTGGCAGTCTCCGGCCAG
GCATGGGGCAAGGGTGGGGACTGCCAGTGTTTGCTTGTGTCTAGGAGTTATGAACAAGCT
GGCCACCAAAATTGGCGTCACCCTGGGTGCCCACCAGCGCTGTCCTGTGTCTTGGGTCTG
TGAGTCAAAGAAAAGGTCCCTGTCCCAGGGAGTGACAGGCAGTAATTAGGCTGAGTTGGG
TGGGGAGGTTTGTCTCGGCCTCCACTGTTCCCGGAAACCGCTGTTCTCCTTGGAACAGCC
ACTGGGAGTTGGAGTGTTTATTTGATTTCTGACTTGCTAAGCCTGTAATTTACCTGCTGG
AACAGACAGAGTCCAGCTGCCCAAACCGTGTCATTAAAAGCAGATCCTGGGCCCGCCCCA
TCCACAGGCACAGCCTGGCAGAGTGGTTCCACCTCCCCATGGGCCCAAGGATGCGCCTCT
CTGGAGTTCACGTGCTGCACCCCCAGGGAGGGGCCTGGGGAGAGCTGGTCCAGCAGCAGG
GGTGGAGGCTGGGGCCACACTGCGGGACAGCAGCCCCTCCACCTGGACCAGGGAGGGCCT
CCATGTGCAAGCGCAGAGGAAGAGACCCTCTCATGTACATAAAGGGTGGGCCCAGGCTGT
CTGGAAGATGGTGAGTTCCCCACTAGTCTAAGGCTTCAAGCTCAGCTAGCAGAGATTGGA
AGAGGCAATGGCCTGAGTGTTAGGAGACAGGTATTCTGGTTCCAACTCAGCCACTGACTT
GGTGTCAGGACAAGTCCCCTTTCTTATTCACGCTTCAGTTTCTCATCTGCAACATGAGGA
CATAGGACTCTTTAATTCCAAAGGCTCTTCCAACCCAGAGAACCCATCTGCCCCCATGAC
CTTCTCCCAGAGCTTGAGACATGGCCTGAGCCCCCTGCTGCCATAGGACTTGGGGCCTAT
CTGCCATTGCAGGACCTGATTTAACAGCTCTCTTCTTCCAATACTGGGCAGTAGAGTTTC
GGAAACTGACAAATGTGTGGTCTCTTCAGTGCCCAGTGTGTAACCTGGCATGGTTTGGGT
GTGCTAGGAGTTTGTGAAATGAATGTTTTCAAGACGCAAACGCTGCTATGCCCATCAGGT
GTGCACAGCAGGCCTGAGGATCATGATGAGACTCCCTTTTTATGCAGCAAAGCACAAAGT
GTGACAGTCGTGGCCTTCCTGGTGGCCAGACTTCTAGCAACTTTAGCCACCCACCAAATG
ACATCACATACAGAAGGCCTCAGAAAGGGAGGAGGTCGTAAGGACACACAGCTGATGAAG
GGTCAGTGCTCAGCTATCAAGGTCATCTTCTGGCCTGGTTGCCTCCCACAGCCCAGGATG
CATTCAAGGCTGCACATCAGGAGCATAAATAAGGGTGGTCAGCTCAGGCCCACTGGCTGC
AACAAGTAGCCACTGACAGGGAGTCTGGGGCCATTTGGTGCAGAACAACCCCCAACCCAG
TGGCCATCTTCACAACTGCAGCACAGTGCTGGCCCTAATGCCAGGTGAGCGTGCAAAGTC
CTGTTTCTTTGTCTTTACATAGGGACCGGGCGATGCGCTTTAGAGAAATTCCCTATTATT
TCACAGGAAAGGAGGCTGTGAAAAGGAGAGGGCAGGTTTTGGAGCCAAGTCGACCTGGCA
TCAGGTCCTGGCTGCCtttttttttttttttttAAAGACATacatggtcttgctttgtcg
cccaggctggagtgcagtggcagtgtcatggctcactgcagcctcaacctgctgggctca
agcaatcctcccacttcagcccgagttgctgggatgacaggcacacgccaccatacccag
ctaatttttaaattttttatagaaaccaggtctcactatgttgcccaggccggtcttaaa
ctttgcccaggccagtcttgaactcctgagctcaagcaatcctcctgcctcagcctccca
aagtgctaggattacaggcgtgagccacTTACCCGGCCTCTGCCTCTTGTTAATTTGACC
ACATCATGTACCTGCTGTGCCCGTTCCTTCCTCCGTAGAAGAGGGTGCTGGTCCTGCCCT
TTTGAGGCCTCCATGAGGGCCAAATGTGCCATGGGACACTTAGTGCCATGCCTGCGCAGA
CCTGTGGAATAAACAGCAATTCTGAGCAGGCTCATTTTAAAGGGACTTGCAAATTTGGGC
GTTCCTTGTGTGCCTTCCTCATAAAACCCACTCCTCCCAGAATATGCTTAGAGGTGCTGC
TGTATTTACCTGAGAGCTATGCTTTTCATCAAAAACCTAAACGTGATCATCTCTTGGATG
AGGTGTGGCCCTGCACACTCGCCTGCTCGTGGAAGGAGTCTGGGCCAGCAGTGACCCACG
CGCTAGGGTCTCTGCTGAGGAAGTGGCAGGTGTGCGGCCCTGCCCTGGCCCCGTAGTGAG
TGTGGGGCCCACCTGTGCCCTCATGGGCAGCTGAAGGGGGAGCTTTCTACCCCAGGTTCC
TTTCCTTACTGAAAAGTCTTGAGCAAACAGTTGCCGCTCTCCACCCCCTGCTTTTTaaaa
aaaaTTTTTTCTCACGTAAGAAAATGTTATCTGTGTGCTGGGGAAAATTTTGAAAATAAC
AAAAACCAGAATACAAACACCCATAATCAATCACAGAGATAACCACTGTTCATAATTCCT
TCCAGTCTTCTTACTTGGCACATATACATTTGTCTTTCTTTATATATGACATATGGATAT
TTTACAAAGTTAGGATCCTACTCTATGCACTGCTTGGTGATCGGATCTATTCAATGTACA
AAATATTTTGAAAGTTTCTGTGATTAAATGTTCTTTGAAAACATAA