>NM_206886 Homo sapiens coiled-coil domain containing 18 (CCDC18), mRNA (4658 bp)
GCGGCCGCGGCGGCGGCGAACACTCCCTCCGAAAGAGAAGCGCAGTTCTCCAAAGGGTAG
GGACTCTGGGCGGGGCTAGCAGTCCTATTCCGCAACCGCCTCAGTCTCGGCCCCCTCAGG
CCAGGCGTGAGCGCCGCCCGCCTCTCCCCCTGACGGCCTCCGGTTCCCATGGCTTCCCCC
ACCAATGGGCATCATGGCGGTAATTGTGGGAAATGTAGTCCCGGGCGGGCTCCGCTAGTG
GGCTCGGGCGCGCTCGCCGACCACGATCCCCGGCAAGCCCCGCGCCTTCGGCGGCGCCTC
ACGCAGTCTGCGCCGGGGCGGGGCAGTGACCGGGTAGGCGCGTCCCAACGGCTCCCGCGG
CGGTTCGAATTCTGTGCTGCCGGGGTTCGCTGGTTCTCCGAGTTGTGTCCGAGGCTTCCA
CGCGCAGGGGCCCGGGAAAGGGTCAGAGGCTTCCTAACGCAGACTCGAGTGCGAAGCGCG
CAGTCGCCGGGTGGGTCTCTCCCCAGCGACGATTTGGGTGAAATGGAATCTAGTTCATCA
GACTACTATAATAAAGACAATGAAGAGGAAAGTTTGCTTGCAAATGTTGCTTCCTTAAGA
CATGAACTGAAGATAACAGAATGGAGTTTGCAGAGTTTAGGGGAAGAGTTATCCAGTGTT
AGTCCAAGTGAAAATTCTGATTATGCCCCTAATCCTTCAAGGTCTGAAAAGCTAATTTTG
GATGTTCAGCCTAGCCACCCTGGACTTTTGAATTATTCACCTTATGAAAACGTCTGTAAA
ATATCTGGTAGCAGCACTGATTTTCAAAAAAAGCCAAGAGATAAGATGTTTTCATCTTCT
GCCCCTGTGGATCAGGAGATTAAAAGCCTTCGAGAGAAACTAAATAAACTTAGGCAACAG
AATGCTTGTTTGGTCACACAGAATCATTCCTTAATGACTAAATTTGAATCTATTCACTTT
GAATTAACACAGTCAAGAGCAAAAGTTTCTATGCTTGAGTCTGCTCAACAGCAGGCAGCC
AGTGTCCCAATCTTAGAAGAACAGATTATAAATTTGGAAGCAGAGGTTTCAGCTCAAGAT
AAAGTTTTGAGAGAGGCAGAAAATAAGCTGGAACAGAGCCAGAAAATGGTAATTGAAAAG
GAACAGAGTTTGCAGGAGTCCAAAGAGGAATGTATAAAATTAAAGGTGGACTTACTTGAA
CAAACCAAACAAGGAAAAAGAGCTGAACGACAAAGGAATGAAGCACTATATAATGCCGAA
GAGCTGAGTAAAGCTTTCCAACAATATaaaaaaaaagtggctgaaaaactggaaaaggtt
caagctgaagaagaaatattagagagaaatctaactaactgtgaaaaagaaaataaaagg
ctacaagaaaggtgtggtctatataaaagtgaacttgaaattctgaaagagaaattaagg
cagttaaaagaagaaaataacaacggaaaagaaaaattaagGATCATGGCAGTGAAAAAT
TCAGAAGTCATGGCACAACTAACTGAATCTAGACAAAGTATTTTGAAGCTAGAGAGTGAG
TTAGAGAACAAAGACGAAATACTTAGAGACAAATTTTCTTTAATGAATGAAAACCGAGAA
TTAAAGGTCCGTGTTGCAGCACAGAATGAGCGACTAGATTTATGTCAACAAGAAATTGAA
AGTTCAAGGGTAGAACTAAGAAGTTTGGAAAAGATTATATCCCAGTTGCCATTAAAAAGA
GAATTATTTGGCTTTAAATCATATCTTTCTAAATACCAGATGAGTAGCTTCTCAAACAAG
GAAGACCGTTGCATTGGCTGCTGTGAGGCAAATAAATTGGTGATTTCGGAATTGAGAATT
AAGCTTGCAATAAAAGAGGCAGAAATTCAAAAGCTTCATGCAAACCTGACTGCAAATCAG
TTATCTCAGAGTCTTATTACTTGTAATGACAGCCAAGAAAGTAGCAAATTAAGTAGTTTA
GAAACAGAACCTGTAAAGCTAGGTGGTCATCAAGTAGCAGAAAGCGTAAAAGATCAAAAT
CAACATACTATGAACAAGCAATATGAAAAAGAGAGGCAAAGACTTGTTACTGGAATAGAA
GAACTACGTACTAAGCTGATACAAATAGAAGCTGAAAATTCTGATTTGAAGGTTAACATG
GCTCACAGAACTAGTCAGTTTCAGCTGATTCAAGAGGAGCTGCTAGAGAAAGCTTCAAAC
TCCAGCAAACTGGAAAGTGAAATGACAAAGAAATGTTCTCAACTTTTAACTCTTGAGAAA
CAGCTGGAAGAAAAGATAGTTGCTTATTCCTCTATTGCTGCAAAAAATGCAGAACTAGAA
CAGGAGCTTATGGAAAAGAATGAAAAGATAAGGAGTCTAGAAACCAATATTAATACAGAG
CATGAGAAAATTTGTTTAGCCTTTGAAAAAGCAAAGAAAATTCACTTGGAACAGCATAAA
GAAATGGAAAAGCAGATTGAAAGACTTGAAGCTCAACTAGAGAAAAAGGACCAACAATTT
AAAGAACAAGAAAAGACTATGTCCATGTTGCAACAAGATATAATATGCAAACAACATCAT
CTTGAATCACTAGATAGACTCTTGACGgaaagcaaaggggaaatgaaaaaggaaaatatg
aagaaagatgaagctttaaaagCATTACAGAACCAAGTATCTGAAGAAACAATCAAGGTT
AGGCAACTAGATTCAGCATTGGAAATTTGTAAGGAAGAACTTGTCTTGCATTTGAATCAA
TTGGAAGGAAATAAGGAAAAGTTTGAAAAACAGTTAAAGAAGAAATCTGAAGAGGTATAT
TGTTTACAGAAAGAGCTAAAGATAAAAAATCACAGTCTTCAAGAGACTTCTGAGCAAAAC
GTTATTCTACAGCATACTCTTCAGCAACAGCAGCAAATGTTACAACAAGAGACAATTAGA
AATGGAGAGCTAGAAGATActcaaactaaacttgaaaaacaggtgtcaaaactggaacaa
gaacttcaaaaacaaagggaaaGTTCAGCTGAAAAGTTGAGAAAAATGGAGGAGAAATGT
GAATCAGCTGCACATGAAGCAGATTTGAAAAGGCAAAAAGTGATTGAGCTTACTGGCACT
GCCAGGCAAGTAAAGATTGAGATGGATCAGTACAAAGAAGAGCTGTCTAAAATGGAAAAG
GAAATAATGCACCTAAAACGAGATGGAGAAAATAAAGCAATGCACCTCTCTCAATTAGAT
ATGATCTTAGATCAGACAAAGACAGAGCTAGAAAAGAAAACAAATGCTGTAAAGGAGTTA
GAAAAGTTACAGCACAGTACTGAAACTGAACTAACAGAAGCCTTGCAAAAACGGGAAGTA
CTTGAGACTGAACTACAAAATGCTCATGGAGAATTAAAAAGTACTTTAAGACAACTCCAG
GAATTGAGAGATGTACTACAGAAGGCTCAATTATCATTAGAGGAAAAATACACTACTATA
AAGGATCTCACAGCTGAACTTAGAGAATGCAAGATGGAGATTGAAGACAAAAAGCAGGAG
CTCCTTGAAATGGATCAGGCACTTAAAGAGAGAAATTGGGAACTAAAGCAAAGAGCAGCT
CAGGTTACACATTTGGATATGACTATTCGTGAGCACAGAGGAGAAATGGAACAAAAAATA
ATTAAATTAGAAGGTACTCTGGAGAAATCAGAATTGGAACTTAAAGAATGTAACAAACAG
ATAGAAAGTCTGAATGACAAATTACAAAATGCTAAAGAACAGCTTCGAGAAAAAGAGTTT
ATAATGCTACAAAATGAACAGGAGATAAGTCAACTGAAAAAAGAAATTGAAAGAACACAA
CAAAGGATGAAAGAAATGGAGAGTGTTATGAAAGAGCAAGAACAGTACATTGCCACTCAG
TACAAGGAGGCCATAGATTTGGGGCAAGAATTGAGGCTGACCCGGGAGCAGGTGCAGAAC
TCTCATACAGAATTGGCAGAGGCTCGTCATCAGCAAGTCCAAGCACAGAGAGAAATAGAA
AGGCTCTCTAGTGAACTGGAGGATATGAAGCAACTCTCTAAAGAGAAAGATGCTCATGGA
AACCATTTAGCTGAAGAACTGGGGGCTTCTAAAGTACGTGAAGCTCATTTAGAAGCAAGA
ATGCAAGCAGAAATCAAGAAATTGTCAGCAGAAGTAGAATCTCTCAAAGAAGCTTATCAT
ATGGAGATGATTTCACATCAAGAGAACCATGCAAAGTGGAAGATTTCTGCTGACTCTCAA
AAGTCTTCTGTTCAGCAACTAAACGAACAGTTAGAGAAGGCAAAATTGGAATTAGAAGAA
GCTCAGGATACTGTAAGCAATTTGCATCAACAAGTCCAAGATAGGAATGAAGTAATTGAA
GCTGCAAATGAAGCATTACTTACTAAAGGAGAAAATGTGTAATTCAAAGAAGATACTGAT
GTGTTGAAAAAATGGAATTTTTGGTACTGTGCTGTTTACTTATTATATGTAGCTCATACT
TCATAGAAGCTGTTATTTTGCTTTTGAATAAATTTTATATTTCAATATTTTAAAAGAAAG
CCCTTCTAAAACttaattatatttttaaagaaaatttattattttatttattgttttttg
gcttaaacttgctgctttcttttgctttttatATAAAA