>X72631 Homo sapiens mRNA for Rev-ErbAalpha protein (hRev gene) (2355 bp)
CCGTTGCCTCAACGTCCAACCCTTCTGCAGGGCTGCAGTCCGGCCACCCCAAGACCTTGC
TGCAGGGTGCTTCGGATCCTGATCGTGAGTCGCGGGGTCCACTCCCCGCCCTTAGCCAGT
GCCCAGGGGGCAACAGCGGCGATCGCAACCTCTAGTTTGAGTCAAGGTCCAGTTTGAATG
ACCGCTCTCAGCTGGTGAAGACATGACCACCCTGGACTCCAACAACAACACAGGTGGCGT
CATCACCTACATTGGCTCCAGTGGCTCCTCCCCAAGCCGCACCAGCCCTGAATCCCTCTA
TAGTGACAACTCCAATGGCAGCTTCCAGTCCCTGACCCAAGGCTGTCCCACCTACTTCCC
ACCATCCCCCACTGGCTCCCTCACCCAAGACCCGGCTCGCTCCTTTGGGAGCATTCCACC
CAGCCTGAGTGATGACGGCTCCCCTTCTTCCTCATCTTCCTCGTCGTCATCCTCCTCCTC
CTTCTATAATGGGAGCCCCCCTGGGAGTCTACAAGTGGCCATGGAGGACAGCAGCCGAGT
GTCCCCCAGCAAGAGCACCAGCAACATCACCAAGCTGAATGGCATGGTGTTACTGTGTAA
AGTGTGTGGGGACGTTGCCTCGGGCTTCCACTACGGTGTGCTCGCCTGCGAGGGCTGCAA
GGGCTTTTTCCGTCGGAGCATCCAGCAGAACATCCAGTACAAAAGGTGTCTGAAGAATGA
GAATTGCTCCATCGTCCGCATCAATCGCAACCGCTGCCAGCAATGTCGCTTCAAGAAGTG
TCTCTCTGTGGGCATGTCTCGAGACGCTGTGCGTTTTGGGCGCATCCCCAAACGAGAGAA
GCAGCGGATGCTTGCTGAGATGCAGAGTGCCATGAACCTGGCCAACAACCAGTTGAGCAG
CCAGTGCCCGCTGGAGACTtcacccacccagcaccccaccccaggccccatgggcccctc
gccaccccctgctccggtcccctcaccccTGGTGGGCTTCTCCCAGTTTCCACAACAGCT
GACGCCTCCCAGATCCCCAAGCCCTGAGCCCACAGTGGAGGATGTGATATCCCAGGTGGC
CCGGGCCCATCGAGAGATCTTCACCTACGCCCATGACAAGCTGGGCAGCTCACCTGGCAA
CTTCAATGCCAACCATGCATCAGGTAGCCCTCCAGCCACCACCCCACATCGCTGGGAAAA
TCAGGGCTGCCCACCTGCCCCCAATGACAACAACACCTTGGCTGCCCAGCGTCATAACGA
GGCCCTAAATGGTCTGCGCCAGGCTCCCTCCTCCTACCCTCCCACCTGGCCTCCTGGCCC
TGCACACCACAGCTGCCACCAGTCCAACAGCAACGGGCACCGTCTATGCCCCACCCACGT
GTATGCAGCCCCAGAAGGCAAGGCACCTGCCAACAGTCCCCGGCAGGGCAACTCAAAGAA
TGTTCTGCTGGCATGTCCTATGAACATGTACCCGCATGGACGCAGTGGGCGAACGGTGCA
GGAGATCTGGGAGGATTTCTCCATGAGCTTCACGCCCGCTGTGCGGGAGGTGGTAGAGTT
TGCCAAACACATCCCGGGCTTCCGTGACCTTTCTCAGCATGACCAAGTCACCCTGCTTAA
GGCTGGCACCTTTGAGGTGCTGATGGTGCGCTTTGCTTCGTTGTTCAACGTGAAGGACCA
GACAGTGATGTTCCTAAGCCGGACCACCTACAGCCTGCAGGAGCTTGGTGCCATGGGCAT
GGGAGACCTGCTCAGTGCCATGTTCGACTTCAGCGAGAAGCTCAACTCCCTGGCGCTTAC
CGAGGAGGAGCTGGGCCTCTTCACCGCGGTGGTGCTTGTCTCTGCAGACCGCTCGGGCAT
GGAGAATTCCGCTTCGGTGGAGCAGCTCCAGGAGACGCTGCTGCGGGCTCTTCGGGCTCT
GGTGCTGAAGAACCGGCCCTTGGAGACTTCCCGCTTCACCAAGCTGCTGCTCAAGCTGCC
GGACCTGCGGACCCTGAACAACATGCATTCCGAGAAGCTGCTGTCCTTCCGGGTGGACGC
CCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTGCCCCCTTGTACAGAATCGAACTCTGCA
CTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAATCTTATTTATATTGTTA
TAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAATACCTGCCTCCCT
CCCCCATCACCGAACTTCCCCTCCTCCCCTATTTAAACCACTCTGTCTCCCCCACAACCC
TCCCCTGGCCCTCTGATTTGTTCTGTTCCTGTCTCAAATCCAATAGTTCACAGCTaaaaa
aaaaaaaaaaaaaaG