>L04961 Mouse nuclear-localized inactive X-specific transcript (Xist) mRNA (14739 bp)
TGTTTGCTCGTTTCCCGTGGATGTGCGGTTCTTCCGTGGTTTCTCTCCATCTAAGGAGCT
TTGGGGGAACATTTTTAGTTCCCCTACCACCAAGCCTTATGGCTTATTTAAGAAAACATA
TCAAAATTCCACGAGATTTTTGACGTTTTGATATGTTCTGGTAAGAttttttttttgaca
tgtcctccatactttttgatatttgtaatattttcagtcaatttttcatttttAAGGAAT
ATTTCTTTGTTGTGCCTTTTGGTTGATACTTGTGTGTGTATGGTGGACTTACCTTTCTTT
CATTGTTTATATAATCTTGCCCATCGGGGCCACGGATACCTGTGTGTCCTCCCCGCCATT
CCATGCCCAACGGGGTTTTGGATACTTACCTGCCttttcattctttttttttcttattat
ttttttttCTAAACTTGCCCATCTGGGCTGTGGATACCTGCTTTTATTCTTTTTTTCTTC
TCCTTAGCCCATCGGGGCCATGGATACCTGCTTTTTGTaaaaaaaaaaaaaaaaaaaaaa
aCCTTTCTCGGTCCATCGGGACCTCGGATACCTGCGTTTAGTCTTTTTTTCCCATGCCCA
ACGGGGCCTCGGATACCTGCTGTTATTAtttttttttctttttcttttgcccatcggggc
tgtggatacctgctttaaattttttttttACAGGCCCAACGGGGCTTGGTGGATGGAAAT
ATGGTTTTGTGAGTTATTGCACTACCTGGAATATCTATGCCTCTTATTTGCGTGTACTGT
TGCTGCTGATCGTTTGGTGCTGTGTGAGTGAACCTATGGCTTAGAAAAACGACTTTGCTC
TTAAACTGAGTGGGTGTTCAGGGCGTGGAGAGCCCGCGTCCGCCATTATGGCTTCTGCGT
GATACGGCTATTCTCGAGCCAGTTACGCCAAGAATTAGGACACCGAGGAGCACAGCGGAC
TGGATAAAAGCAACCAATTGCGCTGCGCTAGCTAAAGGCTTTCTTTATATGTGCGGGGTT
GCGGGATTCGCCTTGATTTGTGGTAGCATTTGCGGGGTTGTGCTAGCCGGAAGAGAAAGC
CAAGGAGTGCTCGTATTAGTGTGCGGTGTTGCGCGGAAGCCGCAGAGGACTAGGGGATAG
GGCTCAGCGTGGGTGTGGGGATTGGGCAGGGTGTGTGTGCATATGGACCCCTGGCGCGGT
CCCCCGTGGCTTTAAGGGCTGCTCAGAAGTCTATAAAATGGCGGCTCGGGGGCTCCACCC
GAGGCTCGACAGCCCAATCTTTGTTCTGGTGTGTAGCAATGGATTATAGGACATTTAGGT
CGTACAGGAAAAGATGGCGGCTCAAGTTCTTGGTGCGGTATAACGCAAAGGGCTTTGTGT
GTCACATGTCAGCTTCATGTCTGAGTTAGCCTGGAGAGGTGGCACATGCTCTTGAATGTG
TCTAAGATGGCGGAAGTCATGTGACCTGCCCTCTAGTGGTTTCTTTCAGTGAtttttttt
ttGGCGGGCTTTAGCTACTTGGCGGGCTTTGCCCGAGGGTACACTTGGTGCATTATGGTA
GGGTGTGGTTGGTCCTACCTTGTGCCACTCGAAGCTGAGGCAAGGCTAAGTGGAAGTGTT
GGTTGCCACTTGACGTAACTCGTCAGAAATGGGCACAAGTGTGAAAGTGTTGGTGTTTGC
TTGACTTCCAGTTAGAAATGTGCATTATTGCTTGGTGGCCAGGATGGAATTAGACTGTGA
TGAGTCACTGTCCCATAAGGACGTGAGTTTCGCTTGGTACTTCACGTGTGTCTTTAGTCA
TCATTTTTTCGAAGTGCCTGCCCAGGTCGGGAGAGCGCATGCTTGCAATTCTAACACTGA
AGTGTTGGATGATGTCGGATCCGATTCGAGAGACCGAGGCTGCGGGTTCTTGGTCGATGT
AAATCATTGAAACCTCACCTATTAAAAGAAAGAAAAGTATCTAAGGCCATTTCAAGGACA
TTTGACTCATCCGCTTGCGTTCATAGTCTCTTACAGTGCTCTATACGTGGCGGTGCAAAC
TAAAACTCAGCCCGTTCCATTCCTTTGTATTGTTCAGTGGCTAGTCTACTTACACCTTGG
CCTCTATTTAGCCAGCACTGATCTCAAGCGGTTCTCTAAGCCTACTGGGTATAAGTGGTG
ACTTTGGCCAGAGTCATAGTGGATCACAAATCACTGGTGAAGAGGTAGAATCCTACCTTC
TTCCAAAATCTACCCCATGACTATTGCTGGGGTTGCATTTTGATTTCAATGAATATTTTG
GATGCCAACGACACGTCTGATAGTGTGCTTTGCTAGTGTTTGAATTTAAAACCGAAGTGA
TTGTTTTCAAAATGTATTTACGGATTTGCTTACTTGTTGAATTCATTTTAATTACCTTTA
GTGAATTGTTACTTTGGAGTCCTTAAAGTTTTCAATAATTTTTTTGGCAGATGATACTCA
AATTACTTGGCACTTAAATGTACTTTCTTTCAAACTCATCCACCGAGCTACTCTTCAAAT
TTTTAAGTCTTATAACACAGATACTGTTAATGTAAAGTGAACATTATGACTGGATGTCAG
GAGTATTTGAGGTTCTATACCAGTTCAGGCTTTGCTTTTGTTGCTATTGTTGATGCTATA
TTGACTAATGGTTTTACTTGTCAGCAAGAGCCTTGAATTGTAATGCTCTGTGTCCTCTAT
CAGACTTACTGTTATAATAGTAATATTAAGGCCTACATTTCAACTTTCTGTGTGTTCTTG
CCTTTATGGCTCTAGATTCTCCTCAAGACTCAGCAAATAGTGCTGCTGCTATTGCtgccc
cagccccaggcccagccccagcccctgccccagccccagccccagcccctgccccagccc
cagcccctgcccctgccccagccccagccccagcccctacccctgcccctgcccctgccc
cacccaaccaacccaatccagtccagccctgccccagcccagtcctagccccaggcccag
ATACTTTCAGACCTATCCCAAGCCCACTTCTACTTAGAGAAATTCGAATCTTCATTGATT
CAGTGCTAAAATGCAGTGTCCATCACTCAGCCTATAAGACTGAGACAGCCCATCTACCCC
CTCCATACTGACTTCTAGAGTCATGGAATTTCACTTAATGCATAGAATCGTATTGCTAAA
ATGCAGTGCCCTCACTCAGCCTATAAGACTGAGATAGCCCATCTATACCCCCTCCATACT
GACTTACAGAGTCATGGAGTTTCACTTAATGCATGCAGTCCTATTGCTAAAATGCAGTGC
CCATAACTCAGCCTATAAGACTGAGATAGCCCATTTATACCCCCATACCCCCTCCATACT
GACTTCTAGGGTCATGGAATTTCACTTAATACATAGAATCGTATTGCTAAAATGCAGTGT
CCATCACTCAGTCTATAAGACTGAGATATCCCTATGTATACCCCATACTCCCTCCATACT
GACTTCCAGAGTCATAGAATTTCACTTTGCATACGGTCCTATTGCTAAAATGCAGTGTCC
ATCACTCAGTCTATAAGACTGAGATATCCCTATGTATACCCCATACTCCCTCCATACTGA
CTTCCAGAGTCATAGAATTTCACTTTGCATACGGTCCTATTGCTAAAATGCAGTGCCCAT
CACTCAGCCTATAAGACTGAGATAGCCCATCTATACCCCCTCCATACTGACTTCCAGAGT
CATGGAATTTCACTTAATGCATGCAGTCCTATTGCTAAAATGCAGTGCCCATCACTCAGC
CTATAAGACTGAGATAGCCCATCTATCCCCATACCCCCTCCATACTGACTTCCAGAGTCA
TGGAATTTCACTTAATGCATGCAGTCCTATTGCTAAAATGCAGTGCCCATCACTCAGCCT
ATAAGACTGAGTAGCCCATCTATACCCACTCCATACTGACTTCCAGGGTCATGGAATTTC
ACTTAATGCATGCAGTCCTATTGCTAAAATGCAGTGCCCATCACTCAGCCTATAAGACTG
AGATAGCCCATCTATACCCACTCCATACTGACTTCCAGAGTCATGGAGTTTCACTTAATG
CATGCAGTCCTATTGCTAAAATGCAGTGCCCATAACTCAGCCTATAAGACTGAGATAGCC
CATTTATACCCCATACCCCCTCCATACTGACTTCTAGGGTCATGGAATTTCACTTAATGC
ATAGAATCGTATTGCTAAAATGCAGTGTCCATTACTCAGCCTATAAGACTGAGATATCCC
TATGTATACCCCATACCCCCTCCATACTGACTTCCAGAGACATAGAATTTCACTTTGCAT
ACGGTCCTATTGCTAAAATGCAGTGCCCATCACTCAGCCTATAAGACTGAGATATCCCTA
TCTATACCCTCTACCCCCTCCATACTGACTTCCAGAGTCATGGAATTTCACATAATGTAT
AGATTTCTATTGCTAAAATGCAGTGCCCATAACTCAGCCTATAAGACTGAGATAGCCCAT
CTATACCCCCTCCATACTGAGTTCCAGAGTCATGGAATTTCACTTAATGCATAGAATCGT
ATTGCTAAAATGCAGTGCCCATCACTCAGCCTATAAGACTGAGCCCATCTATACCCCATA
CCCCTCCATACTGACTTCCAGAGTCATGGAATTTCACTTTGCATACAGTCCTACTTTACT
TGTCCATGGACAAGTAAACAAAGAACTCTTGTCCTTCATGTTAATCAAGATACACCAATC
AAACAAGAGTTTTATATCAGAGACTTGCCATGGGAGGGTATCATCTCTCAAGTCTCCTTT
TCCTTTAAGGAAAGAAAACCATTCTGTCATTGCTGTAGTAGTCACAGTCCCAAGTTTCTA
AGCAGTGTTCAGTCGTCTTTTCTCATGTATTACCTTGAGTACTGAATAATTCTGTCAGAA
ATATTTTGTCCATTGGATTAGACTTTAGCTAGTCCAGCCCTGTGTGCATTTAGCAAAGGG
GCAAACACAGGTCTGTTATCAGACAGTTAAAGTGCTCAGTCCCAATTTTCAAGGCATTGG
CCATTAAAGGGGGTAGAATACTATATACTGTTGGCATGCTGTCATGGGTGCTATCGCCCC
AGGTCACATCTTTCTAACTGATGGAGATACATTTATTTGCTCATGATATTGTATACTAGT
CTCACATGCTTTCTTATTTCAGCCAAAAACCTCTGCACTGGAACATTTTATGTGGATAAT
CCTGACTAGGAATTGAGTCTTTTCTCAAGGTCCTAATACTACCCTTGCTTTATGTAAAGA
GGGTGCTGATTACTTAATGCCTCTTACACAATTGTGCAAAATTGCAGTTGTTCAAGTCCC
CTTCTGTTAGTAACCAAGATCCCATACCCTCATACCCTAATGGGTGACAATCAAGGGTGC
CAACCAATGAGACCACTTCTCTGTTCTGGTCTTTCTGCTGTGCTGGGGAATCAAACCTTG
AGTCTTGTGTACGCTAGTAAAGCACTGTCATAGAGCTACAGCCCCACCGTGTGGTGGTTT
GAGAGAACAGCCTCTTATGTAGCCTGGGCTGGGCGGGACTTACAGGCATTGCCACCTGTA
ATGTAAACATATTTGTGCCTGTTGTGTGCACAGCTGCATTTGTCCCTCTTCCTAAGCATT
GGATAAAGAAACCAAACTAAGTCAAGTCATTTTGTTGGTAATCAAGAAGACCTTTGATCT
GTCCTGTTTTTAACTTCCAGGCTGGCCTGGAACTTAGCATATAACCCAGGCTAGCCTTGA
GCTCAGGATCTAGCCTGCGTTTAACAAGTGTTGGCATATCTGGTTCCTACCACTATGCCC
TGCATGCAGTCTTTCATATTGTGAATGTGCATATGTCATTTCACTGTAGTAATCTGCATC
TGGTGAAGACTTATTTGTATTGCAGCAGTATTTAAGATCCTTAACATAGTAAATGTGCAC
AGTGTTAACTCTATTGTACATATTCTCATGTCCACAGTTGTGCCTTTTAGATCAGGACTC
CTGTACTTAGCAAAGCAAAGAGGCTCACTAATATAAAGCTTCTTTCATGAGACTATAGAT
TGAAACGATTCCAATACGGTCAATGGTCCTTCAAGGTAAGACTTCTGTCTCTGATCATTC
ATATCCTCTTTGCTTTATGGAATTATGTATGTGCTGTGCACTTGAAACCCCTTCCTCAAA
CTATTTATGTACATACTGGCAATTTTAGTAGGATCAATTTTACTCTTAACTTTGAAGTAC
AGAAGTGGTGTTGACCTATAAGGTCCCATTTTGTGGCTTGCTAATAATAATGACTGATTG
TAGTAGGCCTTTTTCTGTTCACTACAGAAGGAAACCTGAACAGCGTAAAACTGTAATGGC
CATAAACATGTACCTTGCATATTAGTATGCATTTACTGCACACATCTCATTCCATTTGGA
TACGATCCTACTCTCAAACCCTTTTGCAGTACAGCAAGGGTCACTAATCTTTTGGCTTCT
TCATCTTCCTGGACACTGGATAAGGCTGTCCCCTCCTTTCCACTCTTTAATTTCCAGGAC
TATTACTTTAAAGACTTAATATTTGCATAAAGGATGGGGTTTTTAATTGATAACATGTCC
CTTGAACATTAATGTATATAACAGGGACATGATCCATTCATTTTAATAAAAATACTTGGC
CAGTTAATGTGTAAAATTACACTTATCCACAACCTTATTACTTTTCGGACCATTGTATCT
CTTGCACTCCTGCAAGGGATACCGTTTATCTCCCAAGGTCCCTGCTAGTGGACCATTAAT
ATACAGTGAATCTTCCTTTGTCTTTGCCAGTAAACAAAGGCCATACTCCTTCGCCTTTCA
TTTGCACTATATCAGGATATGCTGATCAACAAGGCCGCATTCTTTTGGACTGTTATCATA
TATTAAATGTATGCGTATGCACTGCCACCTGCTCTGTGCACTTGAAAGGATCCCACTCAC
TTCCTTAGCACCTTCAGCAGGAAGTGATAATAAGCTCAAGACTTTCATTTGGAAAGTTCA
CATGTCTAAGCACTTCTCTAAGAACTACTGTACCCTCTTCTCCGCTTTAAAGCAGAAAGA
GGGTTGTACGAAGTGCTCTTCATTTGGACTTAAGTGCATTAATGCAGTTAGTTGTCCATC
ATTACCTTTGGAGTTGGATTTTACATCCTTGTACTCTTTTGACACCAGAGGCATATTAAT
TATTTCTGAGCACTTCTCTTGTCAATATTAATCTGTACCCTTACACATATGACCTGTGCG
GCAGCAAAGGTTCTGAAATGCCTACCTTTTGACTGGGGCTGCTGAGTGGTAGTAACTATT
AGTAACCTCAGCATTTGGATGATTACTATGCAAAAATGTCAAGGACCTGTGTGCTCTCTT
TGCATACCATCAAGGCTACTGAGTCCCAGAATTAATTGCTAAGTTAGCGTATTTATAACT
ATGAATGTCTGGAATATTTGTCCCCTTTACATTATTGCAGAGGTTGCTGAGCCCCCGAAA
CTACCCGGTACTGTCAATGAGCACAGGGGCTCTGACGAATGACCTGCTCTCTTCCTTAAA
CTGATTTTGGGACTCTTAATAGGCACAATGGCAGTTCTGGATGGTTTATTTTCTACTCCA
ACTTGAGCAAATCCCCTGCTAGTTTCCCAATGATATAATAAAGTACAGCAGTATGTACAC
CCAACAATGACCCGGATTTCGACCCTTTTTGCATTGCTTTAATATATACAATCCTAAATA
GTCACAATCTCACACTTTATAGTGTTCCTTTTGCCCGGCCACTAGTTTGTCCATTGACCA
CTTTTCTGAATCACTAATTCTCACAAACCCATCATTAAGGAAGAGTTTGTGCCCTTTCTC
AATTCCATCATGCCATCCCTTTTGCCTCTTTGTTTGAACAGTATTGACTGGGCAAAGCCC
TTCTCTTGACTTAAAGTCAACAACACCAGTTTACTCACTTCATATGGCTACAGTGTCTCA
GTTGCCTTCTCCTTGCTCCCACTGAACAGAGACACCTCGAATTCTTACATTATTCTGGGT
AATGTTAATTACCCCAAACACCCTATGTGTCATTAATAAATTTTGGTGTATTTATACACT
GAATAGCAAAAGCAGGCCAAAACTAGGTGGATGAGCCTTCAATCTTTAACTTGCACTTCT
AAATTATTCCAATTCCAACTGCTGGCACATTCTAGGGCCAGGAACCATTCTTGCCTACCT
TTATTAATGCTTTATTGTGCAAAATATTGCAGGCAAGTAGCTCAGGGAGTTGGATTGCCA
CCTTTTACTTGGGGCTTTCCTTTACAGTATGAACTGAAAATTGTCTTCCTGAGAAGGAAG
CTTAGCACTTTTCTTTCCATTCTTCCTCCAGGAAGGAGCCAACTGTCTGCTTAAGAAACT
TTAAGCCCGATTTTGTATATTGCTACTGTACAGGACCAACTGCCAGAAAAGTTATTGATA
ATTTTATTCCTTAAGAAAGGCATTTGGATTGCAAGGTGGATTGACTGTGAGATCATTAGC
TTTTGTGAAGTAAAAATAGCCATTTGTGTCATGTTTCTGAAGACTAAGCAGTGTCTCAGT
GTACTGAGGGTGATGAGTCTGTGGAAAGATCAGTGCAACTATTGCAGAATGTTTAAGACA
AGTATCTTTGCTTGGTCTTTACTACAAGTTTAACAAAACGAAAAAGTCAATCTTTGTGTG
GCCTTTAGTATGATTAACTTTTTGGAAGATGACCTAAGCCTTCTAATCATTATATTTTGT
CTGACATTGGTCACCAGTCCTTGCTTATTTTTAAAAGGTGACTGGATGGATTAAATTTGA
GAACATGTCAAGTCGCCTTTGAAAATTATATAGGCCATCACATTTAATTAATTCATTCTA
TCCACCATTAAACTCTGGCAATAATTTGAAGTAGCTTGAAAATTCCTAAAGTGGGAATTT
ATTTTAGAGATGATAGAACCTGTTTCCCCACTTTACATTTTAAAATATGTCTGCCAGGAT
CTAATCATTCCTTTAAACGTACACTTCAAAGAGAGATTTTCCTAGTAAGAAAAGAGCTTT
CTCTAGTGTGAAGGGTGCTTTGTAGCCGCCGAGTACTTAGGTCTTTTTTGGGAGCTAttg
tgtatgagtgtatgtatgtgtgtgtgtaCATGCATGTTGCTGCGCGCAGTCATTCATTCA
CATGGTGCTCAGACAACAATGGGAGCTGGTTCGTCTATCTTGTGGGTCCTGGAGATCAAA
GTGAGATCATCAGGCTTGGCAGCAAGTGCCTTTACCCTCCGCGTGCCATCTTGCCATCCC
GCTGCTGAGTGTTTGATATGACATTGCTGATGAAAATAATCATCACAACAGCAGTTCTCC
CAGCATTACTGAGAAATGATACTATTTTTCTGAGGAGGATGTTCAAGTAACTCATCCCAG
TGCAGGATCCTGCTTGAACTACTGCTCCTCCGTTACATCAGACTCTGGCTGTTTAGACTA
CAGGATGAATTTGGAGTCTGTTTTGTGCTCCTGCCTCAAGAAGAAGGATTGCCTGGATTT
AGAGGAGTGAAGAGTGCTGGAGAGAGCCCAAAGGGACAAACAATCCCTATGTGAGACTCA
AGGACTGCCAGCAGCCTATACAGCTACATTACATCTCAGCAGAACTTCTCTTCAAGTCCT
CGCTACTCTGAACAAAAAGCTTACAGGCCACATGGAGAAAAAAAGATCTCCCCCCAGAAT
TGTGGGCTTGCTGCTTTGCAGTGCTGGCGACCTATTCCCTTTGACGATCCCTAGGTGGAG
ATGGGGCATGAGGATCCTCCAGGGGAATAGCTCACCACCACTGGGCAACAGGCCTAGCCC
AGATTTCAGTGAGACGCTTTCCTGAACCCAGCAAGGAAGACAAAGGCTCAAAGAATGCCA
CCCTACATCAAAGTAGGAGAAAAGCTGCTGCAATAGTGGCACTGACCTTCGAGGAAGCCA
TTCTGCTCTATTTGGTTCTCTCTCCAGAAGCTAGGAAAGCTTTGCCAGCTGTTTACATAC
TTCAAGATGCACTGCTACCCTACTCATGCCATATAATACACAATGCCATCTACCAAATAT
TACCCTTCCCCAAAGCAGCACAGAAAACTGGGTCTTCAGCGTGATCAAGCAATGTGAACA
CACAAAAGGAAGGCAGCTTTATAAATGACCCGAGGATCAACATGCCTGACTGCAGCATCT
TAAAAGCAATAGAATGAGTGTGTATTGTGGGTGTGTCTATTTCTTGTTTTATGTATCTAT
TTTTTCCTTGGTCTGTGTGTCTAATTCTTTGTTACATCTatttcttccttgctttgtgtg
tctatttcttccttgctttgtgtgtctatttcttccttgCATTATGTCTAATTCTTTGTT
ATATCTATTTCTTCCTTGCTTTGTGTCTATTTCTTCCTTGCAGTTGTGTCTAATTCTTTG
TTACATCTATTTCTTCCTTGCTTTGTGTGTCTATTTCTTCCTTGCATTGTGTCTAATTCT
TTGTTATATCTATTTCTTCCTTGctttgtgtgtctgtcttccttgctttgtgtctatttc
ttccttgcagttgtgtctaattctttgttacatctatttcttccttgcttttgtgtgtct
ttctttcttgcttttgtgtgtctatttcttcCTTGCAGTTGTGTCTAATTCTTTGTTACA
TCTATTTCTTCCTTGCTTTTGTGTGTCTATTTCTTCCTTGCATTGTGTCTAATTCTTTGG
TATATATATTTCTTCATTGCTTTGTGTGTCTATGTCTCCTTGTGTTGTCTAATTCGTTGT
TGCATCTATTTcttccttgctttgtgtgtctatttcttccttgctttgtgtgtctatgtc
ttccttgctttgtgtgtctatgtcttccttgttttgtgtATCTACTTCTTCCTTGTGTGT
CTAATTCTTTGTTACATCTatttcttccttcctttgcatgtctccttctttcctttgtgt
gtcttttctgtctgcagtgtgtCTTACCTATTCCCATGTTTCTCCTGCATGTTCTTTCTT
GCAGAGCTTTGAGCTTTGTTTCACTTTCTCTGGTGCCTGTGTGGTCTGCTTTGTCTTCAC
TAGCTATGGCTCTCTGTTTTATCTATCTGGTTGCTATTTCTCTTAGCTTTTCTTTCACTC
CTGCCTTTCGTGACTCCCTTTGGGTCACATGTTGCATGCATCCCTCTCTTTTTCTTGTGC
TCACCCCACTTGTTCTTTGTTCAAGTTCTCTTTGTCAGTCCATTTCAGTTTTCTTTCTGC
TGCTTCTATCCTTAGTGAATTCTTGTTTACATTTCTTCCCTGCCTTTCTTGGGCCACTTT
CTCTGTTTTCTTTTGATTTTGTGTCTCTTTGCTATTGGTGGATTTCTTATCTCAGCATCA
TTCTGTTGCTTTGTGTTTGCTTGTGTTTCTATCTTCTACTTTCCTCCTTTCTGTTCACTT
TGAGCATTTCATCTCTTTACAAGTCTGTGTCTCTCTTGTATTCTAAAGTAATCCTTTCTT
GGATGTTTCTTtgtatgtacatgtgcgtgtgtgcatgtgtgttatgtgtgtcatgtgtgA
GAGGAGCTTCATAGCCCCTTCCCAATAGGTCCAGAATGTCACCCGTGGAGCCGTTCCTCA
CACCAGACTGCCCTGAGAAATAATCTAAGACAAAATACATCATTCCGTCCGGTCAGGATT
CAAGTGGCTCTGAAGTGAACGCCCAAGTAGAAGACAGAAGTTTTGCGACTTGAGATTTAA
AAGGACCAAAATACACAGATGGCCCGTCTTGAGCTGGCTGGAACGAATGCTGACAACCCA
AAGAAGAGGAACTGTTTCTACAGGACACCTGTGACTTCCAAGAGCGGGGAACTACGTATG
TCATAAGACACAAAACCTGAGCTAAGTCCAAGCATAAGACCTAAGGACCCAATCCTATAT
GGACAGAATATTTAAGAGATAAAGGCCTATGGCCCAGAACTCTGGAAGGATATTTCTATC
CTTCTATCCCCAAGACCAAGAAGGGAAATTCGAAGATGAGACCTGCCCCCCAACCCCAGC
ATCCCTTTCCATTTCTTATATTTCTATTTAAGCTGTCTTCACTTGAGATGTAATTTTTCA
TTGTTGCCATTGCCCATAAAGGAATACGTTTTTAGCTGGATAGTATTGTGCAAGGGTCTG
TTTTAAACTGGGTCTTAGCCATTTGTTAAATTGTTGATGTTTTACAACTTCCATTTCTCT
TCACATCTGCTCCACTTGAGACGGAACTAAATCCAGCCAGTGTATATAGCCTGACTATTG
AAACTTCCCTAGGAATAAGCATGCATACAGATATGCATACTGCCATCCTCCCTACCTCAG
AAGCCCTAGGCTGACAAGAAAAGGAAAGCATCAGGTTGTTAGGGGGAAAACAATGTCAGG
CTATCTAGAGAAAATATAAAGAGTTGTTCCAGACCAATGAGAAGAATTAGACAAGCAATA
TGCAGATGTGCCAACCCTCTGAGAAGCACCAGCCAGTGTCACCTTCTTTCTTTGGGCTTA
GGTGAGCAGGGTATGGTTTTCTAATAATGGTTTGGGGACAAAATGAGGTCTGAACTCCCT
GCTCATAGTAGTGGCCGAGTAATTTGGTGCATTTCACCAAAGGAACTCCTGGGTCTAATA
CCTACCTTTAAAATTAATGATGAGAGACTCTAAGGACTACTTAACGGGCTTAATCTTTTT
CGTGCCTTCCTCTTCCTCTGTAAGAGGGAAGTTAAATGACACAGGATGAAAAAGTTACAT
GCTCATAGCACATTGGCAATTATACATGGTTATTATCTGAAAGTGTAGAGCTTTTCCTAT
AAGGCATCAGACTAAGTACCTGAAGCTTTGTGGGTTCATGGTCTTAGTTGCATATTCCTT
AGTTGCAAATCCTTTTCAAAAGGTAAGAAAAAGGCACACTGGTCTATTGCCTGGACTTGA
TCAAGCCCTGATATGAATGCCAGGGAATGTCTGAGTAACATTAATTTCCTTCCCTGCATA
TTTTTTGTGCTGAATACTAAGGCTGTGATGCTTCACTGTGGTCACCCCCAGGTAACAAGA
TATTACCAGGTAACCAGGAAACGTATGAATACGTAAACCATGAAGCCTACTGTAACTTCC
AAGTCAGTGCTGAGTATGTATTACATAGTAGCTAAAGTCTACGCCTCTGTGTGCTATAGG
CACAAAGATTGCTCTAGGAATAACATGCTTTGTAAAAACAAATATATGAACATAACGGGG
CTTGAATGAATAACAGTCCATATACTTAAGGCCAGTGTGTTTCTTCTGCTTTGGTGAGGC
TCAGTAAGTTATATTATACCAGGTAGCAGAAGAGAAAACACATGGAAACTGATTTTAAAC
TACAAACTAGGTCACTAATGCAGGTGATTGATTACCCTATTCTGATCACCTTCTAATTTC
TGAATACCCATGTTCAGCACTGGGAATAACAAAGGGGGACATTACCACAGAACTAGAATT
TACAAAAGAATGCATTAAATAAAGCATTATACAGCTATCAATTGTTCCATGTGTGCAAAT
GAATGACTACTAACTACCTCTGATGTATCCGATATTGTTTTGGGTACATGAAATATTCAT
GAGTAACTGCCATGAAATAAGAATGTTTGCATTCCATACTATTCATAATGAATGAGCCAA
TGCTTAATTTAATCAGTCAAAACTTGAGTGATAAGGGCATGTTAAGACAAGAACATTTGC
CCAGGTCACATTATGGTTGTGGGTATCTTCTCAACTATAAAGCAGTTCAGTAGTATAAGA
CAAGACAAATTTTCTATAGAAATAAAGCTGCCTATAAAATAGGCATAGTCTCTACAAAAT
TTTCATCGTACTTTTTAGCCCATAATGGGAAGAGTACAGTTAACAACCTGGGTGTGTTAG
CATGTGCTCTCAGCTTAAGCAACAGGACCACTTGACCCCAGAAATTGGAGGCTAGCCTGG
GAAGACCATAAGGTCCATCTCAAACCTGGAGGCTAAATATTGTCTCCCATGTGTATATTC
TCTTTCATGGGTACTGGAGAGATACACAGACGTACATTTCAGTGTGTCCACACTTGAGAA
TAATATGTACGTTGGCATTTTATGCACTCGGAGGTACCATATAAATATAACAATTCATTT
TCTTACTTGGTATCAATTTCCAGGCTTTTAAAATTCTGCCACATTTATTATACTGTGAAA
ATAAAGTAAATAAGTAACTGTGAACCACTGAATATATGAAGCATTCAATACTTGATGAGT
ACATACTGAATGGCAGTCATTTATTACAAAACAGTGCCCTTGCTAGGCACTGGGATGCAA
AGAGCATTCTCATTGTCCTGTGTATCTAAAGAAATTATGCATGAGATTAATTTATAATTT
GTAAACTGCCATATATATGTGTATATATGCAATATTTGCCTGGTGTGCAATGACTTTGCT
TTTATCCCAGGCATGCACAACAGATCTGTGTGGAGCTTTGTGAAGTCTACAGTTCTATAA
AGCCGGGACCTAACTGTTGGCTTTATCAGTGAACAGTGATTACTTTCTAAGTTTCATAAT
GGCTGAAACTTAATCATAATGCTTATCACCTAACACCACCTAATAATAATTTTACCATGC
TATGTGTTGAGCGAACACATAGATTGCTTTCTAGCATTATGTAGCACTTATAGGAGTGAA
ATCTAGACCAAAACTTCAATTCACTTCAATGAGGAAATG